{"id":16602189,"url":"https://github.com/rishav394/java-programming-cse1007","last_synced_at":"2026-04-22T10:34:00.711Z","repository":{"id":125396611,"uuid":"236571095","full_name":"rishav394/Java-Programming-CSE1007","owner":"rishav394","description":"This repository is going to have all the solutions to cycle sheet from CSE1007 - Java Programming at VIT University, Vellore.","archived":false,"fork":false,"pushed_at":"2020-02-18T06:02:50.000Z","size":24,"stargazers_count":2,"open_issues_count":0,"forks_count":0,"subscribers_count":0,"default_branch":"master","last_synced_at":"2025-03-16T13:24:06.828Z","etag":null,"topics":[],"latest_commit_sha":null,"homepage":"https://rishav394.github.io/Java-Programming-CSE1007/","language":"Java","has_issues":true,"has_wiki":null,"has_pages":null,"mirror_url":null,"source_name":null,"license":null,"status":null,"scm":"git","pull_requests_enabled":true,"icon_url":"https://github.com/rishav394.png","metadata":{"files":{"readme":"README.md","changelog":null,"contributing":null,"funding":null,"license":null,"code_of_conduct":null,"threat_model":null,"audit":null,"citation":null,"codeowners":null,"security":null,"support":null,"governance":null,"roadmap":null,"authors":null,"dei":null,"publiccode":null,"codemeta":null}},"created_at":"2020-01-27T19:11:05.000Z","updated_at":"2021-05-31T15:43:59.000Z","dependencies_parsed_at":null,"dependency_job_id":"69972106-3bf4-488e-a331-4f0b26485a81","html_url":"https://github.com/rishav394/Java-Programming-CSE1007","commit_stats":null,"previous_names":[],"tags_count":0,"template":false,"template_full_name":null,"purl":"pkg:github/rishav394/Java-Programming-CSE1007","repository_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories/rishav394%2FJava-Programming-CSE1007","tags_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories/rishav394%2FJava-Programming-CSE1007/tags","releases_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories/rishav394%2FJava-Programming-CSE1007/releases","manifests_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories/rishav394%2FJava-Programming-CSE1007/manifests","owner_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/owners/rishav394","download_url":"https://codeload.github.com/rishav394/Java-Programming-CSE1007/tar.gz/refs/heads/master","sbom_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories/rishav394%2FJava-Programming-CSE1007/sbom","scorecard":null,"host":{"name":"GitHub","url":"https://github.com","kind":"github","repositories_count":286080680,"owners_count":32132565,"icon_url":"https://github.com/github.png","version":null,"created_at":"2022-05-30T11:31:42.601Z","updated_at":"2026-04-22T08:34:57.708Z","status":"ssl_error","status_checked_at":"2026-04-22T08:34:55.583Z","response_time":58,"last_error":"SSL_read: unexpected eof while reading","robots_txt_status":"success","robots_txt_updated_at":"2025-07-24T06:49:26.215Z","robots_txt_url":"https://github.com/robots.txt","online":false,"can_crawl_api":true,"host_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub","repositories_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repositories","repository_names_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/repository_names","owners_url":"https://repos.ecosyste.ms/api/v1/hosts/GitHub/owners"}},"keywords":[],"created_at":"2024-10-12T00:20:54.385Z","updated_at":"2026-04-22T10:34:00.697Z","avatar_url":"https://github.com/rishav394.png","language":"Java","funding_links":[],"categories":[],"sub_categories":[],"readme":"# Java Programming CSE1007\n\nThis repository is going to have all the solutions to cycle sheet from CSE1007-Java Programming at VIT University, Vellore.\n\n## Assignments - 13329 - DEEPIKAA S\n\nSince I have this course under her I will also upload the assignments she gives apart from the cycle sheet\n\n*  [Prime Number]()\n*  [Pyramid pattern]()\n*  [Right angle triangle pattern]()\n*  [Simple and Comound interest]()\n\n## Assignments - 10247 - JAISANKAR N\n\n* [Current And Saving Accounts]()\n\n\n## Cycle Sheet (List of Challenging Experiments (Indicative))\n\nEach assignment number from List of Challenging Experiments is named as `q[number]` under the Cycle Sheet folder. It can be a direct `.java` file or a folder, if the solution contains more than one files or deals with custom packages. Or you can just navigate to that file by clicking these links below.\n\n1. Write a program to demonstrate the knowledge of students in basic Java concepts. [Solution](Cycle%20Sheet/q1.java)\n\n    \u003eEg., Write a program to read the First name and Last name of a person, his weight and height using command line arguments. Calculate the BMI Index which is defined as the individual's body mass divided by the square of their height.\n    \u003e\n    \u003e| Category | BMI Range-Kg/m2 |\n    \u003e|------------------------------- |----------------------- |\n    \u003e| Underweight | \u003c18.5 |\n    \u003e| Normal (healthy weight) | 18.5 to 25 |\n    \u003e| Overweight | 25 to 30 |\n    \u003e| Obese Class | Over 30 |\n    \u003e\n    \u003eDisplay the name and display his category based on the BMI value thus calculated.\n\n  \n2. Write a program to demonstrate the knowledge of students in multidimensional arrays and looping constructs. [Solution](Cycle%20Sheet/q2.java)\n\n    \u003e Eg., If there are 4 batches in BTech(IT) learning ‘ITE2005’ course, read the count of the slow learners (who have scored \u003c25) in each batch. Tutors should be assigned in the ratio of 1:4 (For every 4 slow learners, there should be one tutor). Determine the number of tutors for each batch. Create a 2-D jagged array with 4 rows to store the count of slow learners in the 4 batches. The number of columns in each row should be equal to the number of groups formed for that particular batch ( Eg., If there are 23 slow learners in a batch, then there should be 6 tutors and in the jagged array, the corresponding row should store 4, 4, 4, 4, 4,3). Use for-each loop to traverse the array and print the details. Also print the number of batches in which all tutors have exactly 4 students.\n\n3. Write a program to demonstrate the knowledge of students in String handling. [Solution](Cycle%20Sheet/q3.java)\n\n    \u003e Eg., Write a program to read a chemical equation and find out the\n    \u003e count of the reactants and the products. Also display the count of the\n    \u003e number of molecules of each reactant and product.\n    \u003e \n    \u003e Eg., For the equation, 2NaOH + H2SO4 -\u003e Na2SO4+ 2H2O,  the O/P  should\n    \u003e be as follows.\n    \u003e \n    \u003e Reactants are 2 moles of NaOH,  1 mole of H2SO4.\n    \u003e \n    \u003e Products are 1 mole of Na2SO4 and 2 moles of H2O\n\n4. Write a program to demonstrate the knowledge of students in advanced concepts of Java string handling. [Solution](Cycle%20Sheet/q4.java)\n\n    \u003e Eg., (_Bioinformatics: finding genes_) Biologists use a sequence of\n    \u003e letters **A**, **C**, **T**, and **G** to model a genome. A gene is a\n    \u003e substring of a genome that starts after a triplet **ATG** and ends\n    \u003e before a triplet **TAG**, **TAA**, or **TGA**. Furthermore, the length\n    \u003e of a gene string is a multiple of 3 and the gene does not contain any\n    \u003e of the triplets **ATG**, **TAG**, **TAA**, and **TGA**. Write a\n    \u003e program that prompts the user to enter a genome and displays all genes\n    \u003e in the genome. If no gene is found in the input sequence, displays no\n    \u003e gene. Here are the sample runs:\n    \u003e \n    \u003e Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT\n    \u003e \n    \u003e O/P:  TTT\n    \u003e \n    \u003e GGGCGT\n\n5. Write a program to demonstrate the knowledge of students in working with classes and objects. [Solution](Cycle%20Sheet/q5.java)\n\n    \u003e Eg.,Create a class Film with string objects which stores name,\n    \u003e language and lead_actor and category (action/drama/fiction/comedy).\n    \u003e Also include an integer data member that stores the duration of the\n    \u003e film. Include parameterized constructor, default constructor and\n    \u003e accessory functions to film class. Flim objects can be initialized\n    \u003e either using a constructor or accessor functions. Create a class\n    \u003e FilmMain that includes a main function. In the main function create a\n    \u003e vector object that stores the information about the film as objects.\n    \u003e Use the suitable methods of vector class to iterate the vector object\n    \u003e to display the following\n    \u003e \n    \u003e a. The English film(s) that has Arnold\n    \u003e as its lead actor and that runs for shortest duration.\n    \u003e \n    \u003e b. The Tamil film(s) with Rajini as\n    \u003e lead actor.\n    \u003e \n    \u003e c. All the comedy movies.\n\n6. Write a program to demonstrate the knowledge of students in creation of abstract classes and working with abstract methods. [Solution](Cycle%20Sheet/q6.java)\n\n    \u003e Eg., Define an abstract class ‘Themepark’ and inherit 2 classes\n    \u003e ‘Queensland’ and ‘Wonderla’ from the abstract class. In both the theme\n    \u003e parks, the entrance fee for adults is Rs. 500 and for children it is\n    \u003e Rs. 300. If a family buys ‘n’ adult tickets and ‘m’ children tickets,\n    \u003e define a method in the abstract class to calculate the total cost.\n    \u003e Also, declare an abstract method playGame() which must be redefined in\n    \u003e the subclasses.\n    \u003e \n    \u003e In Queensland, there are a total of 30 games. Hence create a Boolean\n    \u003e array named ‘Games’ of size 30 which initially stores false values for\n    \u003e all the elements. If the player enters any game code that has already\n    \u003e been played, a warning message should be displayed and the user should\n    \u003e be asked for another choice.  In Wonderla, there are a total of 40\n    \u003e different games. Thus create an integer array with 40 elements. Here,\n    \u003e the games can be replayed, until the user wants to quit. Finally\n    \u003e display the total count of games that were repeated and count of the\n    \u003e games which were not played at all.\n\n7. Write a program to demonstrate the knowledge of students in Java Exception handling. [Solution](Cycle%20Sheet/q7.java)\n\n    \u003e Eg., Read the Register Number and Mobile Number of a student. If the\n    \u003e Register Number does not contain exactly 9 characters or if the Mobile\n    \u003e Number does not contain exactly 10 characters, throw an\n    \u003e IllegalArgumentException.  If the Mobile Number contains any character\n    \u003e other than a digit, raise a NumberFormatException. If the Register\n    \u003e Number contains any character other than digits and alphabets, throw a\n    \u003e NoSuchElementException. If they are valid, print the message ‘valid’\n    \u003e else ‘invalid’\n\n\n8. Write a program to demonstrate the knowledge of students in working with user-defined packages and sub-packages. [Solution](Cycle%20Sheet/q8)\n\n    \u003e Eg., Within the package named ‘primespackage’, define a class Primes\n    \u003e which includes a method checkForPrime() for checking if the given\n    \u003e number is prime or not. Define another class named TwinPrimes outside\n    \u003e of this package which will display all the pairs of prime numbers\n    \u003e whose difference is 2. (Eg, within the range 1 to 10, all possible\n    \u003e twin prime numbers are (3,5), (5,7)). The TwinPrimes class should make\n    \u003e use of the checkForPrime() method in the Primes class.\n\n\n9. Write a program to demonstrate the knowledge of students in File handling. [Half solution](Cycle%20Sheet/q9.java)\n\n    \u003e Eg., Define a class ‘Donor’ to store the below mentioned details of  a\n    \u003e blood donor.\n    \u003e \n    \u003e Name, age, Address, Contact number, blood group, date of last donation\n    \u003e \n    \u003e Create ‘n’ objects of this class for all the regular donors at\n    \u003e Vellore. Write these objects to a file. Read these objects from the\n    \u003e file and display only those donors’ details whose blood group is\n    \u003e ‘A+ve’ and had not donated for the recent six months.\n\n\n## Disclaimer\n[I (rishav394)](https://github.com/rishav394/) take no responsibility for any code, be it working or not what so ever.\n\nIf you find some bug or a suggestion please open an issue or create a pull request or drop me an email at rishav394@gmail.com\n\n## Contributions\n\n* [rishav394](https://github.com/rishav394/) - original work\n\n    \u003e Feel free to add your name and respective contribution when submitting a pull request.","project_url":"https://awesome.ecosyste.ms/api/v1/projects/github.com%2Frishav394%2Fjava-programming-cse1007","html_url":"https://awesome.ecosyste.ms/projects/github.com%2Frishav394%2Fjava-programming-cse1007","lists_url":"https://awesome.ecosyste.ms/api/v1/projects/github.com%2Frishav394%2Fjava-programming-cse1007/lists"}