An open API service indexing awesome lists of open source software.

https://github.com/0xnu/nwunsch_lua

Needleman–Wunsch algorithm implementation in Lua.
https://github.com/0xnu/nwunsch_lua

bioinformatics needlemanwunsch nucleotide nucleotide-sequence nucleotides protein

Last synced: 2 months ago
JSON representation

Needleman–Wunsch algorithm implementation in Lua.

Awesome Lists containing this project

README

        

## nwunsch

[Needleman–Wunsch](https://en.wikipedia.org/wiki/Needleman%E2%80%93Wunsch_algorithm) algorithm implementation in Lua.

### Features

- **Sequence Comparison**: The package enables the comparison of two sequences (seq1 and seq2) by considering all possible alignments and choosing the best one.

- **Scoring System**: The scoring system is customisable with match, mismatch, and gap parameters, allowing users to define the reward for matched characters and penalties for mismatches and gaps.

- **Matrix Generation and Population**: It creates a dynamic programming matrix of sequence lengths and populates it accordingly based on optimal alignment values.

- **Traceback Functionality**: It includes a traceback procedure which identifies the optimal path through the matrix, producing the final alignment of the input sequences.

- **Efficient Evaluation**: It utilises a max function to determine the maximum score between match, mismatch, and gap; this feature guarantees the efficiency of the sequence alignment process.

### Installation

Install the `nwunsch` package in your `Lua` project by installing it with the following command:

```shell
luarocks install nwunsch
```

### Usage

```lua
local nwunsch = require("nwunsch")

-- Use the package functions
local seq1 = "AGACTAGTTACCGTAGGCTCGAGTCGGATCGGATCGGATCGGATCAA"
local seq2 = "CGAGACGTGACCTTAGGCTCGAGTCGGATCGGATCGGATCGGA"
local match = 2
local mismatch = -1
local gap = -2

local score, align1, align2 = nwunsch.NeedlemanWunsch(seq1, seq2, match, mismatch, gap)
print("Alignment score:", score)
print("Alignment 1:", align1)
print("Alignment 2:", align2)
```

> Use Case: Execute the `gene.lua` sample code in the [examples](./examples/gene.lua) directory.

### License

This project is licensed under the [MIT License](./LICENSE).

### Copyright

(c) 2024 [Finbarrs Oketunji](https://finbarrs.eu).

📚📚 Go and [purchase a Lua book](https://feistyduck.gumroad.com/).