https://github.com/0xnu/nwunsch_lua
Needleman–Wunsch algorithm implementation in Lua.
https://github.com/0xnu/nwunsch_lua
bioinformatics needlemanwunsch nucleotide nucleotide-sequence nucleotides protein
Last synced: 2 months ago
JSON representation
Needleman–Wunsch algorithm implementation in Lua.
- Host: GitHub
- URL: https://github.com/0xnu/nwunsch_lua
- Owner: 0xnu
- License: mit
- Created: 2024-04-11T00:18:05.000Z (about 1 year ago)
- Default Branch: main
- Last Pushed: 2024-04-25T05:08:34.000Z (about 1 year ago)
- Last Synced: 2025-02-08T16:46:00.066Z (4 months ago)
- Topics: bioinformatics, needlemanwunsch, nucleotide, nucleotide-sequence, nucleotides, protein
- Language: Lua
- Homepage:
- Size: 30.3 KB
- Stars: 0
- Watchers: 1
- Forks: 0
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- Contributing: CONTRIBUTING.md
- Funding: .github/FUNDING.yml
- License: LICENSE
- Code of conduct: CODE_OF_CONDUCT.md
- Codeowners: CODEOWNERS
- Security: SECURITY.md
Awesome Lists containing this project
README
## nwunsch
[Needleman–Wunsch](https://en.wikipedia.org/wiki/Needleman%E2%80%93Wunsch_algorithm) algorithm implementation in Lua.
### Features
- **Sequence Comparison**: The package enables the comparison of two sequences (seq1 and seq2) by considering all possible alignments and choosing the best one.
- **Scoring System**: The scoring system is customisable with match, mismatch, and gap parameters, allowing users to define the reward for matched characters and penalties for mismatches and gaps.
- **Matrix Generation and Population**: It creates a dynamic programming matrix of sequence lengths and populates it accordingly based on optimal alignment values.
- **Traceback Functionality**: It includes a traceback procedure which identifies the optimal path through the matrix, producing the final alignment of the input sequences.
- **Efficient Evaluation**: It utilises a max function to determine the maximum score between match, mismatch, and gap; this feature guarantees the efficiency of the sequence alignment process.
### Installation
Install the `nwunsch` package in your `Lua` project by installing it with the following command:
```shell
luarocks install nwunsch
```### Usage
```lua
local nwunsch = require("nwunsch")-- Use the package functions
local seq1 = "AGACTAGTTACCGTAGGCTCGAGTCGGATCGGATCGGATCGGATCAA"
local seq2 = "CGAGACGTGACCTTAGGCTCGAGTCGGATCGGATCGGATCGGA"
local match = 2
local mismatch = -1
local gap = -2local score, align1, align2 = nwunsch.NeedlemanWunsch(seq1, seq2, match, mismatch, gap)
print("Alignment score:", score)
print("Alignment 1:", align1)
print("Alignment 2:", align2)
```> Use Case: Execute the `gene.lua` sample code in the [examples](./examples/gene.lua) directory.
### License
This project is licensed under the [MIT License](./LICENSE).
### Copyright
(c) 2024 [Finbarrs Oketunji](https://finbarrs.eu).
📚📚 Go and [purchase a Lua book](https://feistyduck.gumroad.com/).