Ecosyste.ms: Awesome

An open API service indexing awesome lists of open source software.

Awesome Lists | Featured Topics | Projects

https://github.com/BenLangmead/bowtie2

A fast and sensitive gapped read aligner
https://github.com/BenLangmead/bowtie2

bioinformatics c-plus-plus genomics read-aligners

Last synced: 2 months ago
JSON representation

A fast and sensitive gapped read aligner

Awesome Lists containing this project

README 

        



![Random Tests](https://github.com/BenLangmead/bowtie2/actions/workflows/random-tests.yml/badge.svg)

![Simple Tests](https://github.com/BenLangmead/bowtie2/actions/workflows/simple-tests.yml/badge.svg)

[![Version](https://img.shields.io/badge/version-2.5.4-green.svg)](https://shields.io/)



[![License: GPL v3](https://img.shields.io/badge/license-GPLv3-blue.svg)](https://www.gnu.org/licenses/gpl-3.0)



## Overview



*Bowtie 2* is an ultrafast and memory-efficient tool for aligning sequencing reads

to long reference sequences. It is particularly good at aligning reads of about 50

up to 100s or 1,000s of characters, and particularly good at aligning to relatively

long (e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index to keep

its memory footprint small: for the human genome, its memory footprint is typically

around 3.2 GB. Bowtie 2 supports gapped, local, and paired-end alignment modes.



## Obtaining Bowtie2



*Bowtie 2* is available from various package managers, notably

[Bioconda](https://anaconda.org/bioconda/bowtie2). With Bioconda installed, you

should be able to install Bowtie 2 with `conda install bowtie2`.



Containerized versions of Bowtie 2 are also available via the

[Biocontainers](https://biocontainers.pro/) project (e.g. via

[Docker Hub](https://hub.docker.com/r/biocontainers/bowtie2/)).



You can also download Bowtie 2 sources and binaries from the

"releases" tab on this page. Binaries are available for the Linux,

Mac OS X, and Windows. By utilizing the [SIMDE project](https://github.com/simd-everywhere/simde)

Bowtie 2 now supports the following architectures: ARM64, PPC64, and

s390x.  If you plan to compile Bowtie 2 yourself, make sure you at least have

the [zlib](https://www.zlib.net) library and header files installed. See the

[Building from source](http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml#building-from-source)

section of the manual for details.



## Getting started

Looking to try out Bowtie 2? Check out the [Bowtie 2 UI](http://bit.ly/bt2ui-beta) (currently in beta).



### Alignment

`bowtie2` takes a Bowtie 2 index and a set of sequencing read files and outputs a

set of alignments in SAM format.



"Alignment" is the process by which we discover how and where the read sequences are

similar to the reference sequence. An "alignment" is a result from this process,

specifically: an alignment is a way of "lining up" some or all of the characters in

the read with some characters from the reference in a way that reveals how they're

similar. For example:



```

  Read:      GACTGGGCGATCTCGACTTCG

             |||||  |||||||||| |||

  Reference: GACTG--CGATCTCGACATCG

```

Where dash symbols represent gaps and vertical bars show where aligned characters match.



We use alignment to make an educated guess as to where a read originated with

respect to the reference genome. It's not always possible to determine this with

certainty. For instance, if the reference genome contains several long stretches of

As (`AAAAAAAAA` etc.) and the read sequence is a short stretch of As (`AAAAAAA`), we

cannot know for certain exactly where in the sea of As the read originated.



**Examples**

```

# Aligning unpaired reads

bowtie2 -x example/index/lambda_virus -U example/reads/longreads.fq



# Aligning paired reads

bowtie2 -x example/index/lambda_virus -1 example/reads/reads_1.fq -2 example/reads/reads_2.fq

```



### Building an index



`bowtie2-build` builds a Bowtie index from a set of DNA sequences. `bowtie2-build`

outputs a set of 6 files with suffixes `.1.bt2`, `.2.bt2`, `.3.bt2`, `.4.bt2`,

`.rev.1.bt2`, and `.rev.2.bt2`. In the case of a large index these suffixes will

have a `bt2l` termination. These files together constitute the index: they are all

that is needed to align reads to that reference. The original sequence FASTA files

are no longer used by Bowtie 2 once the index is built.



Bowtie 2's `.bt2` index format is different from Bowtie 1's `.ebwt` format, and they

are not compatible with each other.



**Examples**

```

# Building a small index

bowtie2-build example/reference/lambda_virus.fa example/index/lambda_virus



# Building a large index

bowtie2-build --large-index example/reference/lambda_virus.fa example/index/lambda_virus

```



### Index inpection



`bowtie2-inspect` extracts information from a Bowtie 2 index about what kind of

index it is and what reference sequences were used to build it. When run without any

options, the tool will output a FASTA file containing the sequences of the original

references (with all non-A/C/G/T characters converted to Ns). It can also be used to

extract just the reference sequence names using the `-n/--names` option or a more

verbose summary using the `-s/--summary` option.



**Examples**

```

# Inspecting a lambda_virus index (small index) and outputting the summary

bowtie2-inspect --summary example/index/lambda_virus



# Inspecting the entire lambda virus index (large index)

bowtie2-inspect --large-index example/index/lambda_virus

```



## Publications



### Bowtie 2 Papers



- Langmead B, Wilks C., Antonescu V., Charles R. __[Scaling read aligners to hundreds of threads on general-purpose processors](https://doi.org/10.1093/bioinformatics/bty648)__. [Bioinformatics](https://academic.oup.com/bioinformatics). bty648.



- Langmead B, Salzberg S. __[Fast gapped-read alignment with Bowtie 2](http://www.nature.com/nmeth/journal/v9/n4/full/nmeth.1923.html)__. [Nature Methods](http://www.nature.com/nmeth). 2012, 9:357-359.



- Langmead B, Trapnell C, Pop M, Salzberg SL. __[Ultrafast and memory-efficient alignment of short DNA sequences to the human genome](https://genomebiology.biomedcentral.com/articles/10.1186/gb-2009-10-3-r25)__. [Genome Biology](https://genomebiology.biomedcentral.com/) 10:R25.



### Related Publications



- P. Ferragina, G. Manzini __[Opportunistic data structures with applications](https://ieeexplore.ieee.org/document/892127)__. [IEEE Xplore](http://genomebiology.com/) 10.1109/SFCS.2000.892127



## Related Work



Check out the [Bowtie 2 UI](http://bit.ly/bt2ui-beta), a [shiny](https://shiny.rstudio.com), frontend to the Bowtie 2 command line.