https://github.com/ChangqingW/SeqSizzle
https://github.com/ChangqingW/SeqSizzle
Last synced: about 1 year ago
JSON representation
- Host: GitHub
- URL: https://github.com/ChangqingW/SeqSizzle
- Owner: ChangqingW
- License: agpl-3.0
- Created: 2023-11-07T07:09:19.000Z (over 2 years ago)
- Default Branch: master
- Last Pushed: 2024-12-17T06:06:20.000Z (over 1 year ago)
- Last Synced: 2024-12-17T06:28:37.772Z (over 1 year ago)
- Language: Rust
- Size: 5.22 MB
- Stars: 10
- Watchers: 1
- Forks: 1
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- License: LICENSE.md
Awesome Lists containing this project
- awesome-ratatui - seqsizzle - A pager for viewing FASTQ files with fuzzy matching and coloring. (💻 Apps / 🌌 Other)
- awesome-genome-visualization - SeqSizzle - genome-visualization/seqsizzle.png) (based)
README
SeqSizzle is a pager for viewing FASTQ files with fuzzy matching, allowing different adaptors to be colored differently.
# Installation
### Pre-built binary
[](https://github.com/ChangqingW/SeqSizzle/actions/workflows/rust.yml)
You can simply download and run the binary from [Github Actions](https://github.com/ChangqingW/SeqSizzle/releases/latest).
### Conda
SeqSizzle is also available on [bioconda](https://bioconda.github.io/recipes/seqsizzle/README.html):
```
conda install -c bioconda -c conda-forge seqsizzle
```
### Cargo (crates.io)
[](https://crates.io/crates/seqsizzle)
[](https://crates.io/crates/seqsizzle)
If you already have [a Rust environment set up](https://rustup.rs), you can use the `cargo install` command:
```
cargo install seqsizzle
```
Cargo will build the `seqsizzle` binary and place it in `$HOME/.local/share/cargo/bin/seqsizzle`.
### Cargo (git)
If you already have a Rust environment set up, you can use the `cargo install` command in your local clone of the repo:
```
git clone https://github.com/ChangqingW/SeqSizzle
cd SeqSizzle
cargo install --path .
```
Cargo will build the `seqsizzle` binary and place it in `$HOME/.cargo`.
# Usage
`./seqsizzle -h`:
```
Usage: seqsizzle [OPTIONS] [COMMAND]
Commands:
summarize Summarize the reads with patterns specified by the --patterns argument or the adapter flags. Make sure you supply the flags BEFORE the subcommand, e.g. `./SeqSizzle my.fastq -p my_patterns.csv --adapter-3p summarize`. '..' indicats unmatched regions of positive length, '-' indicates the patterns are overlapped, print the number of reads that match each pattern combination in TSV format. To be moved to the UI in the future
help Print this message or the help of the given subcommand(s)
Arguments:
The FASTQ file to view
Options:
--adapter-3p
Start with 10x 3' kit adaptors:
- Patrial Read1: CTACACGACGCTCTTCCGATCT (and reverse complement)
- Partial TSO: AGATCGGAAGAGCGTCGTGTAG (and reverse complement)
- Poly(>10)A/T
--adapter-5p
Start with 10x 5' kit adaptors
- Patrial Read1: CTACACGACGCTCTTCCGATCT (and reverse complement)
- TSO: TTTCTTATATGGG (and reverse complement)
- Patrial Read2: AGATCGGAAGAGCACACGTCTGAA (and reverse complement)
- Poly(>10)A/T
-p, --patterns
Start with patterns from a CSV file
Must have the following header:
pattern,color,editdistance,comment
-s, --save-patterns
Save the search panel to a CSV file before quitting. To be removed in the future since you can now hit Ctrl-S in the search panel to save the patterns
-h, --help
Print help
-V, --version
Print version
```
## Navigation
### Viewer mode

Up / down arrow (or `j` / `k`) to scroll by one line, `Ctrl+U` / `Ctrl+D` to scoll half a screen.
`/` (or `Ctrl+F`) to toggle search panel, `q` to quit
### search panel mode

Left / right arrow (or Tab / Shift-Tab) to cycle through different input fields and the patterns list.
When on the patterns list field, up / down arrows cycle through patterns, `Backspace` (or `Delete`, `d`) to delete the selected pattern and `Return` to pop the pattern into the input fields for editing.
`Return` to add current inputs into the search pattern list (when focusing on any of the input boxes, rather than the patterns list).
Use **Shift +** arrow keys to move cursor within an input field (as arrow keys alone are bind to cycling input fields).
`/` or `Esc` to close the search panel.
# Roadmap
## functionality
* Gzip (`fastq.gz`) support
* Filter reads by match
* Counting reads with match
## UI
* Make elements in the search panel clickable, try implementations discussed in [ratatui repo](https://github.com/ratatui-org/ratatui/discussions/552)
## Misc
* Unit tests