An open API service indexing awesome lists of open source software.

https://github.com/Danko-Lab/proseq2.0

Preprocesses and Aligns Run-On Sequencing (PRO/GRO/ChRO-seq) data from Single-Read or Paired-End Illumina Sequencing
https://github.com/Danko-Lab/proseq2.0

Last synced: about 1 year ago
JSON representation

Preprocesses and Aligns Run-On Sequencing (PRO/GRO/ChRO-seq) data from Single-Read or Paired-End Illumina Sequencing

Awesome Lists containing this project

README

          

# Proseq2.0
Preprocesses and Aligns Run-On Sequencing (PRO/GRO/ChRO-seq) data from Single-Read or Paired-End Illumina Sequencing. It is a new version of ProseqMapper (https://github.com/Danko-Lab/utils/tree/master/proseq).

Currently we provide two commands: proseq mapper and bigWig merge.

## Overview
Our proseq2.0 pipeline will take single-end or paired-end sequencing reads in fastq.gz format as input. The pipeline will automate three routine pre-processing and alignment options, including
+ pre-processing reads: remove the adapter sequence and quality trim the reads (cutadapt), deduplicate the reads if UMI barcodes are used (prinseq-lite.pl)
+ mapping reads to a reference genome (BWA)
+ converting BAM files into bedGraph and BigWig formats (kentsource). When converting to bedGraph and BigWig, the pipeline only report the 5’ end position of the reads after UMI/adapter removal. For pair-end sequencing, user can choose to report the 5’ end of R1 or R2 reads. The output BigWig files ending with _minus.bw or _plus.bw are raw read counts without normalization. The RPM normalized outputs end with a suffix of .rpm.bw.

To run our pipeline users must first download the pipeline files and install dependencies indicated in this README.md. In addition, user need to provide a path to a BWA index file and the path to the chromInfo file for the genome of choice. After running this pipeline, users should have processed data files in the specified output directory.

Please consider the following notes on the genome index file:

* Please note that proseq2.0 does __NOT__ include steps to ensure chrM reads are really from mitochondrial RNA polymerase. All reads mapped to rRNA or chrM will be removed from bigWig files.

* The reference genome used for read mapping should include a copy of the rDNA to avoid misalignment to genomic rDNA repeats. We use GenBank ID# U13369.1 (https://www.ncbi.nlm.nih.gov/nuccore/555853) for most studies. Your work may require using a species-specific rDNA reference.

* The reference genome should strip out chromosomes representing alternative haplotypes (*_hap or *_random).

## Citation
Chu, T., Wang, Z., Chou, S. P., & Danko, C. G. (2018). Discovering Transcriptional Regulatory Elements From Run‐On and Sequencing Data Using the Web‐Based dREG Gateway. Current protocols in bioinformatics, e70.

## Dependencies

The pipelines depend on several common bioinformatics tools:
- [ ] cutadapt (https://cutadapt.readthedocs.io/en/stable/installation.html)
- [ ] fastx_trimmer (http://hannonlab.cshl.edu/fastx_toolkit/commandline.html)
- [ ] seqtk (https://github.com/lh3/seqtk)
- [ ] prinseq-lite.pl (https://sourceforge.net/projects/prinseq/files/standalone/)
- [ ] bwa (https://sourceforge.net/projects/bio-bwa/files/)
- [ ] samtools version: 1.9 (http://www.htslib.org/download/)
- [ ] bedtools v2.28.0 (http://bedtools.readthedocs.org/en/latest/)
- [ ] bedops (https://bedops.readthedocs.io/en/latest/)
- [ ] bedGraphToBigWig (from the Kent source utilities http://hgdownload.cse.ucsc.edu/admin/exe/)

Please make sure you can call the bioinformatics tools from your current working directory.

## Usage
```
Preprocesses and aligns PRO-seq data.

Takes PREFIX.fastq.gz (SE), PREFIX_1.fastq.gz, PREFIX_2.fastq.gz (PE)
or *.fastq.gz in the current working directory as input and writes
BAM and bigWig files as output to the user-assigned output-dir.
The output bigWig files ending with _minus.bw or _plus.bw are raw read counts without normalization.
The RPM normalized outputs end with a suffix of .rpm.bw.

Requirements in current working directory:
cutadapt 1.8.3, fastx_trimmer, seqtk, prinseq-lite.pl 0.20.2, bwa, samtools, bedtools, and bedGraphToBigWig.

bash proseq2.0.bsh [options]

options:

To get help:
-h, --help Show this brief help menu.

Required options:
-SE, --SEQ=SE Single-end sequencing.
-PE, --SEQ=PE Paired-end sequencing.
-i, --bwa-index=PATH Path to the BWA index of the target genome
(i.e., bwa index).
-c, --chrom-info=PATH Location of the chromInfo table.

I/O options:
-I, --fastq=PREFIX Prefix for input files.
Paired-end files require identical prefix
and end with _1.fastq.gz and _2.fastq.gz
eg: PREFIX_1.fastq.gz, PREFIX_2.fastq.gz.
-T, --tmp=PATH Path to a temporary storage directory.
-O, --output-dir=DIR Specify a directory to store output in.

Required options for SE
-G, --SE_READ=RNA_5prime Single-end sequencing from 5' end of
nascent RNA, like GRO-seq.
-P, --SE_READ=RNA_3prime Single-end sequencing from 3' end of
nascent RNA, like PRO-seq.

Options for PE
--RNA5=R1_5prime Specify the location of the 5' end of RNA
[default: R1_5prime].
--RNA3=R2_5prime Specify the location of the 3' end of RNA
[default: R2_5prime].
Available options: R1_5prime: the 5' end of R1 reads
R2_5prime: the 5' end of R2 reads
-5, --map5=TRUE Report the 5' end of RNA [default on, --map5=TRUE].
-3, --map5=FALSE Report the 3' end of RNA,
only available for PE [default off, --map5=TRUE].
-s, --opposite-strand=TRUE
Enable this option if the RNA are at the different strand
as the reads set at RNA5 [default: disable].

Optional operations:
--ADAPT_SE=TGGAATTCTCGGGTGCCAAGG
3' adapter to be removed from the 3' end of SE reads.
[default:TGGAATTCTCGGGTGCCAAGG]
--ADAPT1=GATCGTCGGACTGTAGAACTCTGAACG
3' adapter to be removed from the 3' end of R2.
[default:GATCGTCGGACTGTAGAACTCTGAACG]
--ADAPT2=AGATCGGAAGAGCACACGTCTGAACTC
3' adapter to be removed from the 3' end of R1.
[default:AGATCGGAAGAGCACACGTCTGAACTC]

--UMI1=0 The length of UMI barcode on the 5' of R1 read.
[default: 0]
--UMI2=0 The length of UMI barcode on the 5' of R2 read.
[default: 0]
When UMI1 or UMI2 are set > 0, the pipeline will perform PCR deduplicate.

--Force_deduplicate=FALSE
When --Force_deduplicate=TRUE, it will force the pipeline to
perform PCR deduplicate even there is no UMI barcode
(i.e. UMI1=0 and UMI2=0). [default: FALSE]
--ADD_B1=0 The length of additional barcode that will be trimmed
on the 5' of R1 read. [default: 0]
--ADD_B2=0 The length of additional barcode that will be trimmed
on the 5' of R2 read. [default: 0]
--thread=1 Number of threads can be used [default: 1]

-4DREG Using the pre-defined parameters to get the most reads
for dREG package. Please use this flag to make the bigWig
files compatible with dREG algorithm. Only available for
Single-end sequencing.[default: off]
-aln Use BWA-backtrack [default: SE uses BWA-backtrack (aln), PE uses BWA-MEM (mem)]
-mem Use BWA-MEM [default: SE uses BWA-backtrack (aln), PE uses BWA-MEM (mem)]
--MAP_LENGTH Set a data-set wide length cutoff for mapping (e.g. --MAP_LENGTH=36)
or map the whole reads after QC (off, --MAP_LENGTH=0). [default: off]

```

## Examples
The pipeline requires two parameters for genome information, including BWA index (--bwa-index) and chrom info (--chrom-info).

__BWA index__ should be generated using the __bwa index__ command according to BWA manual at http://bio-bwa.sourceforge.net/bwa.shtml . Please note that the program only take in the prefix when you assign the index, no ".bwt" in the end. See the BWA manual for more details.

__Chrom info__ is a tab-delimited file with two columns. The first column is the chromosome name and the second is the size of the chromosome. Please see see /input_file_exmaples/mm10.chromInfo for example

```
bwa index Genome.fa.gz # Don't do this if you already have bwa index
export bwaIndex=Genome.fa.gz # Or path to your bwa index
export chromInfo=PathToChromInfo
```

### Example 1

PREFIX.fastq.gz were made according to GRO-seq protocol as in https://www.ncbi.nlm.nih.gov/pubmed/19056941
Give UMI1=6, the pipeline will remove PCR duplicates and trim the 6bp UMI barcode.
```
bash proseq2.0.bsh -i $bwaIndex -c $chromInfo -SE -G -T myOutput1 -O myOutput1 --UMI1=6 -I PREFIX
```
### Example 2

PREFIX.fastq.gz were made according to PRO-seq protocol as in https://www.ncbi.nlm.nih.gov/pubmed/23430654
UMI1 was set to 0 by default. The pipeline will NOT remove PCR duplicates.
```
bash proseq2.0.bsh -i $bwaIndex -c $chromInfo -SE -P -T myOutput2 -O myOutput2 -I PREFIX
```
### Example 3

__PREFIX_1.fastq.gz__ and __PREFIX_2.fastq.gz__ were Paired-End sequenced as in chromatin run-on and sequencing (ChRO-seq) in https://www.biorxiv.org/content/early/2017/09/07/185991
* Please note that Paired-end files require identical PREFIX and end with _1.fastq.gz and _2.fastq.gz.

Assign the file use __-I PREFIX__. No _1.fastq.gz, _2.fastq.gz, nor *fastq.gz is in the end.
* There is a 6N UMI barcode on R1. Pipeline will perform PCR deduplicat.
```
bash proseq2.0.bsh -i $bwaIndex -c $chromInfo -PE --RNA3=R1_5prime -T myOutput3 -O myOutput3 -I PREFIX --UMI1=6 --ADAPT1=GATCGTCGGACTGTAGAACTCTGAAC --ADAPT2=TGGAATTCTCGGGTGCCAAGG
```
### Example 4
Same as in Example 3 but without UMI barcode.
* UMI1 and UMI2 were set to 0 by default. The pipeline will NOT remove PCR duplicates.
```
bash proseq2.0.bsh -i $bwaIndex -c $chromInfo -PE --RNA3=R1_5prime -T myOutput4 -O myOutput4 -I PREFIX --ADAPT1=GATCGTCGGACTGTAGAACTCTGAAC --ADAPT2=TGGAATTCTCGGGTGCCAAGG
```
### Example 5
If you made ChRO-seq library with High-throughput Adapters from Danko lab __AND all the samples have distinct i7 barcode.__
* Please note that proseq2.0.bsh does __NOT__ work if there your samples share i7 barcode.
```
bash proseq2.0.bsh -i $bwaIndex -c $chromInfo -PE --UMI1=4 --UMI2=4 --ADD_B1=6 -T myOutput5 -O myOutput5 -I PREFIX
```

## Useful references

* GRO-seq: http://www.sciencemag.org/content/322/5909/1845.long
* PRO-seq: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3974810/
* dREG: http://www.nature.com/nmeth/journal/v12/n5/full/nmeth.3329.html

## Notes for **CBSUdanko** users:

1. Setup your environment to use the bioinformatics tools (e.g. prinseq-lite.pl,bedGraphToBigWig,samtools...)
```
export PATH=$PATH:/programs/prinseq-lite-0.20.2:/programs:/home/zw355/lib/bin:/home/zw355/lib/ucsc
```

2. Find the BWA index and chromosome table in the server:
```
export human_genome=/local/storage/data/short_read_index/hg19/bwa.rRNA-0.7.5a-r405/hg19.rRNA
export human_chinfo=/local/storage/data/hg19/hg19.chromInfo

export mouse_genome=/local/storage/data/short_read_index/mm10/bwa.rRNA-0.7.8-r455/mm10.rRNA.fa.gz
export mouse_chinfo=/local/storage/data/mm10/mm10.chromInfo

export dog_genome=/local/storage/data/short_read_index/canFam3/bwa.rRNA-0.7.8-r455/canFam3.rRNA.fa
export dog_chinfo=/local/storage/data/canFam3/canFam3.chromInfo
```

3. Using --UMI1=6 to replace -b6 if you have used it in the old version (proseqMapper.bsh).

## Notes for **dREG** users:

In order to make the most compatible with dREG algorithm, please use **-4DREG** flag when you process the PRO-seq and GRO-seq reads. The dREG package needs enriched reads to
detect the transcriptional peaks, we use the "bwa aln" to do mappping and set lower filtering score (0) to get the most reads in this pipeline. Only available for Single-end sequencing.

Here is an examples to generate the bigWig for dREG.

```
bash proseq2.0.bsh -SE -G -4DREG -i $dog_genome -c $dog_chinfo -I ./example1_R1 -T ./tmpdir -O ./outputdir
```