An open API service indexing awesome lists of open source software.

https://github.com/a-r-j/graphein

Protein Graph Library
https://github.com/a-r-j/graphein

bioinformatics computational-biology deep-learning dgl drug-discovery gene-regulatory-networks geometric-deep-learning graph-neural-networks interactome interactomics ppi-networks protein protein-data-bank protein-design protein-structure python pytorch pytorch-geometric rna structural-biology

Last synced: over 1 year ago
JSON representation

Protein Graph Library

Awesome Lists containing this project

README

          

[![Binder](https://mybinder.org/badge_logo.svg)](https://mybinder.org/v2/gh/a-r-j/graphein-binder/master?urlpath=git-pull%3Frepo%3Dhttps%253A%252F%252Fgithub.com%252Fa-r-j%252Fgraphein%26urlpath%3Dlab%252Ftree%252Fgraphein%252Fnotebooks%26branch%3Dmaster)
[![PyPI version](https://badge.fury.io/py/graphein.svg)](https://badge.fury.io/py/graphein)
![supported python versions](https://img.shields.io/pypi/pyversions/graphein)
[![Docs](https://assets.readthedocs.org/static/projects/badges/passing-flat.svg)](http://www.graphein.ai)
[![DOI:10.1101/2020.07.15.204701](https://zenodo.org/badge/DOI/10.1101/2020.07.15.204701.svg)](https://doi.org/10.1101/2020.07.15.204701)
[![Project Status: Active – The project has reached a stable, usable state and is being actively developed.](https://www.repostatus.org/badges/latest/active.svg)](https://www.repostatus.org/#active) [![Project Status: Active – The project has reached a stable, usable state and is being actively developed.](https://www.repostatus.org/badges/latest/active.svg)](https://www.repostatus.org/#active)
[![CodeFactor](https://www.codefactor.io/repository/github/a-r-j/graphein/badge)](https://www.codefactor.io/repository/github/a-r-j/graphein)
[![Quality Gate Status](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=alert_status)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Bugs](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=bugs)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Maintainability Rating](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=sqale_rating)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Reliability Rating](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=reliability_rating)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Gitter chat](https://badges.gitter.im/gitterHQ/gitter.png)](https://gitter.im/graphein)
[![License: MIT](https://img.shields.io/badge/License-MIT-yellow.svg)](https://opensource.org/licenses/MIT)
Code style: black









[Documentation](http://www.graphein.ai) | [Paper](https://proceedings.neurips.cc/paper_files/paper/2022/hash/ade039c1db0391106a3375bd2feb310a-Abstract-Conference.html) | [Tutorials](http://graphein.ai/notebooks_index.html) | [Installation](#installation)

Protein & Interactomic Graph Library

This package provides functionality for producing geometric representations of protein and RNA structures, and biological interaction networks. We provide compatibility with standard PyData formats, as well as graph objects designed for ease of use with popular deep learning libraries.

## What's New?

| | | |
|---|---|---|
| 1.7.0 | [FoldComp Datasets](http://graphein.ai/notebooks/foldcomp.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/foldcomp.ipynb) |
| 1.7.0 | [Creating Datasets from the PDB](http://graphein.ai/notebooks/creating_datasets_from_the_pdb.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/creating_datasets_from_the_pdb.ipynb) |
| 1.6.0 | [Protein Tensor Module](http://graphein.ai/notebooks/protein_tensors.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/protein_tensors.ipynb) |
| 1.5.0 | [Protein Graph Creation from AlphaFold2!](http://graphein.ai/notebooks/alphafold_protein_graph_tutorial.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/residue_graphs.ipynb) |
| 1.5.0 | [RNA Graph Construction from Dotbracket notation](http://graphein.ai/modules/graphein.rna.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/rna_graph_tutorial.ipynb) |
| 1.4.0 | [Constructing molecular graphs](http://graphein.ai/notebooks/molecule_tutorial.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/molecule_tutorial.ipynb) |
| 1.3.0 | [Ready-to-go Dataloaders for PyTorch Geometric](http://graphein.ai/notebooks/dataloader_tutorial.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/dataloader_tutorial.ipynb) |
| 1.2.0 | [Extracting subgraphs from protein graphs](http://graphein.ai/notebooks/subgraphing_tutorial.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/subgraphing_tutorial.ipynb) |
| 1.2.0 | [Protein Graph Analytics](http://graphein.ai/notebooks/protein_graph_analytics.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/protein_graph_analytics.ipynb) |
| 1.2.0 | [Graphein CLI](http://graphein.ai/getting_started/usage.html) | |
| 1.2.0 |[Protein Graph Visualisation!](http://graphein.ai/notebooks/interactive_plotly_example.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/interactive_plotly_example.ipynb)
| 1.1.0 | [Protein - Protein Interaction Network Support & Structural Interactomics (Using AlphaFold2!)](http://graphein.ai/notebooks/ppi_tutorial.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/ppi_graph.ipynb) |
| 1.0.0 | [High and Low-level API for massive flexibility - create your own bespoke workflows!](http://graphein.ai/notebooks/residue_graphs.html) | [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/residue_graphs.ipynb) |

## Example usage

Graphein provides both a programmatic API and a command-line interface for constructing graphs.

### CLI

Graphein configs can be specified as `.yaml` files to batch process graphs from the commandline.

[Docs](http://graphein.ai/getting_started/usage.html)

```bash
graphein -c config.yaml -p path/to/pdbs -o path/to/output
```

### Creating a Protein Graph

| | | |
|---|---|---|
[Tutorial (Residue-level)](http://graphein.ai/notebooks/residue_graphs.html) | [Tutorial (Atomic)](http://graphein.ai/notebooks/atom_graph_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.graphs)
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/residue_graphs.ipynb) | [![Open In Colab(https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/atom_graph_tutorial.ipynb) | |

```python
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph

config = ProteinGraphConfig()
g = construct_graph(config=config, pdb_code="3eiy")
```

### Creating a Protein Graph from the AlphaFold Protein Structure Database

| | |
|---|---|
| [Tutorial](http://graphein.ai/notebooks/alphafold_protein_graph_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.graphs) |
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/alphafold_protein_graph_tutorial.ipynb)|

```python
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
from graphein.protein.utils import download_alphafold_structure

config = ProteinGraphConfig()
fp = download_alphafold_structure("Q5VSL9", aligned_score=False)
g = construct_graph(config=config, path=fp)
```

### Creating a Protein Mesh

| | |
|---|---|
| [Tutorial](http://graphein.ai/notebooks/protein_mesh_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.meshes) |
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/protein_mesh_tutorial.ipynb) | |

```python
from graphein.protein.config import ProteinMeshConfig
from graphein.protein.meshes import create_mesh

verts, faces, aux = create_mesh(pdb_code="3eiy", config=config)
```

### Creating Molecular Graphs

Graphein can create molecular graphs from smiles strings as well as `.sdf`, `.mol2`, and `.pdb` files

| | |
|---|---|
| [Tutorial](http://graphein.ai/notebooks/molecule_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.molecule.html) |
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/molecule_tutorial.ipynb) | |

```python
from graphein.molecule.config import MoleculeGraphConfig
from graphein.molecule.graphs import construct_graph

g = create_graph(smiles="CC(=O)OC1=CC=CC=C1C(=O)O", config=config)

```

### Creating an RNA Graph

| | |
|---|---|
|[Tutorial](http://graphein.ai/notebooks/rna_notebooks.html) | [Docs](http://graphein.ai/modules/graphein.rna.html) |
|[![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/rna_graph_tutorial.ipynb) | |

```python
from graphein.rna.graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph(dotbracket='..(((((..(((...)))..)))))...',
sequence='UUGGAGUACACAACCUGUACACUCUUUC')
```

### Creating a Protein-Protein Interaction Graph

| | |
|---|---|
| [Tutorial](http://graphein.ai/notebooks/ppi_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.ppi.html) |
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/ppi_graph.ipynb)|

```python
from graphein.ppi.config import PPIGraphConfig
from graphein.ppi.graphs import compute_ppi_graph
from graphein.ppi.edges import add_string_edges, add_biogrid_edges

config = PPIGraphConfig()
protein_list = ["CDC42", "CDK1", "KIF23", "PLK1", "RAC2", "RACGAP1", "RHOA", "RHOB"]

g = compute_ppi_graph(config=config,
protein_list=protein_list,
edge_construction_funcs=[add_string_edges, add_biogrid_edges]
)
```

### Creating a Gene Regulatory Network Graph

| | |
|---|---|
|[Tutorial](http://graphein.ai/notebooks/grn_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.grn.html) |
| [![Open In Colab](https://colab.research.google.com/assets/colab-badge.svg)](https://colab.research.google.com/github/a-r-j/graphein/blob/master/notebooks/grn_tutorial.ipynb) |

```python
from graphein.grn.config import GRNGraphConfig
from graphein.grn.graphs import compute_grn_graph
from graphein.grn.edges import add_regnetwork_edges, add_trrust_edges

config = GRNGraphConfig()
gene_list = ["AATF", "MYC", "USF1", "SP1", "TP53", "DUSP1"]

g = compute_grn_graph(
gene_list=gene_list,
edge_construction_funcs=[
partial(add_trrust_edges, trrust_filtering_funcs=config.trrust_config.filtering_functions),
partial(add_regnetwork_edges, regnetwork_filtering_funcs=config.regnetwork_config.filtering_functions),
],
)
```

## Installation

### Pip

The simplest install is via pip. *N.B this does not install ML/DL libraries which are required for conversion to their data formats and for generating protein structure meshes with PyTorch 3D.* [Further details](http://graphein.ai//getting_started/installation.html)

```bash
pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot
```

However, there are a number of (optional) utilities ([DSSP](https://anaconda.org/salilab/dssp), [PyMol](https://pymol.org/2/), [GetContacts](https://getcontacts.github.io/)) that are not available via PyPI:

```
conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation

# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts

# Add folder to PATH
echo "export PATH=\$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:

cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb \
--trajectory 5xnd_trajectory.dcd \
--itypes hb \
--output 5xnd_hbonds.tsv
```

### Conda environment

The dev environment includes GPU Builds (CUDA 11.1) for each of the deep learning libraries integrated into graphein.

```bash
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .
```

A lighter install can be performed with:

```bash
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .
```

### Dockerfile

We provide two `docker-compose` files for CPU (`docker-compose.cpu.yml`) and GPU usage (`docker-compose.yml`) locally. For GPU usage please ensure that you have [NVIDIA Container Toolkit](https://docs.nvidia.com/datacenter/cloud-native/container-toolkit/install-guide.html) installed. Ensure that you install the locally mounted volume after entering the container (`pip install -e .`). This will also setup the dev environment locally.

To build (GPU) run:

```
docker-compose up -d --build # start the container
docker-compose down # stop the container
```

## Citing Graphein

Please consider citing graphein if it proves useful in your work.

```bibtex
@inproceedings{jamasb2022graphein,
title={Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks},
author={Arian Rokkum Jamasb and Ramon Vi{\~n}as Torn{\'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell},
booktitle={Advances in Neural Information Processing Systems},
editor={Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho},
year={2022},
url={https://openreview.net/forum?id=9xRZlV6GfOX}
}

```