https://github.com/adnaniazi/tailfindr
An R package for estimating poly(A)-tail lengths in Oxford Nanopore RNA and DNA reads.
https://github.com/adnaniazi/tailfindr
bioinformatics cdna nanopore r rna
Last synced: about 1 year ago
JSON representation
An R package for estimating poly(A)-tail lengths in Oxford Nanopore RNA and DNA reads.
- Host: GitHub
- URL: https://github.com/adnaniazi/tailfindr
- Owner: adnaniazi
- License: gpl-3.0
- Created: 2018-07-30T11:17:54.000Z (almost 8 years ago)
- Default Branch: master
- Last Pushed: 2024-10-14T06:20:18.000Z (almost 2 years ago)
- Last Synced: 2024-11-13T20:40:45.580Z (over 1 year ago)
- Topics: bioinformatics, cdna, nanopore, r, rna
- Language: R
- Homepage: https://www.cbu.uib.no/valen/
- Size: 18.5 MB
- Stars: 53
- Watchers: 3
- Forks: 18
- Open Issues: 17
-
Metadata Files:
- Readme: README.Rmd
- License: LICENSE
Awesome Lists containing this project
- awesome-nanopore - tailfindr - [R] - [tailfindr: Alignment-free poly(A) length measurement for Oxford Nanopore RNA and DNA sequencing](https://rnajournal.cshlp.org/content/early/2019/07/02/rna.071332.119). (Software packages / Poly(A) tail length estimation)
README
---
output: github_document
---
```{r, include = FALSE}
knitr::opts_chunk$set(
collapse = TRUE,
comment = "#>",
fig.path = "man/figures/README-",
out.width = "100%"
)
options(tibble.print_min = 5, tibble.print_max = 5)
```

## tailfindr?
tailfindr is a R package for estimating poly(A)-tail lengths in Oxford Nanopore reads.
## Features of *tailfindr*
* Works for both RNA and DNA reads. In the case of DNA reads, it estimates both poly(A)- and poly(T)-tail lengths.
* Supports data that has been basecalled with Albacore or Guppy. It also support data that has been basecalled using the newer 'flipflop' model.
* Can work on single or multi-fast5 file reads.
*tailfindr* has been developed at [Valen Lab](https://www.cbu.uib.no/valen/) in [Computational Biology Unit](https://www.cbu.uib.no/) at the [University of Bergen](https://www.uib.no/), Norway.
## Installation
#### Step 1. Installing VBZ plugin
VBZ is a compression format used by Nanopore to compress the data inside a FAST5 file. You must install VBZ plugin for your operating system so that tailfindr can successfully read FAST5 files. Download and install VBZ plugin from [here](https://github.com/nanoporetech/vbz_compression/releases).
#### Step 2. Installing HDF5 library
tailfindr depends on the HDF5 library for reading Fast5 files. For OS X and Linux, the HDF5 library needs to be installed via one of the (shell) commands specified below:
| System | Command
|:------------------------------------------|:---------------------------------|
|**OS X (using Homebrew)** | `brew install hdf5`
|**Debian-based systems (including Ubuntu)**| `sudo apt-get install libhdf5-dev`
|**Systems supporting yum and RPMs** | `sudo yum install hdf5-devel`
HDF5 1.8.14 has been pre-compiled for Windows and is available [here](https://github.com/mannau/h5-libwin) — thus no manual installation is required.
#### Step 3. Installing devtools
Currently, *tailfindr* is not listed on CRAN/Bioconductor, so you need to install it using `devtools`. To install `devtools` use the following command in R/R-studio:
```{r, message = FALSE, eval = FALSE}
install.packages("devtools")
```
#### Step 4. Installing rbokeh
rbokeh has been delisted from CRAN and therefore tailfindr cannot install itself. You need to manually install it yourself using the command below:
```{r, message = FALSE, eval = FALSE}
devtools::install_url('https://cran.r-project.org/src/contrib/Archive/rbokeh/rbokeh_0.5.1.tar.gz', type = "source", dependencies = TRUE)
```
#### Step 5. Installing tailfindr
Now you can install tailfindr using the command below in R/R-studio:
````{r, message = FALSE, eval = FALSE}
devtools::install_github("adnaniazi/tailfindr")
```
If you also want to build the vignette while installing tailfindr, then run the command below:
```{r, message = FALSE, eval = FALSE}
remotes::install_github('adnaniazi/tailfindr', build = TRUE, build_opts = c("--no-resave-data", "--no-manual"), force = TRUE)
```
Now you are ready to use *tailfindr*.
## Usage
#### 1. Minimal working example
`find_tails()` is the main function that you can use to find tail lengths in both RNA and DNA reads. It saves a CSV file containing all the tail-length data. Furthermore, it also returns the same data as a tibble.
Give below is a minimal use case in which we will run tailfindr on example RNA reads present in the tailfindr package.
```{r, message = FALSE, eval = FALSE}
library(tailfindr)
df <- find_tails(fast5_dir = system.file('extdata', 'rna', package = 'tailfindr'),
save_dir = '~/Downloads',
csv_filename = 'rna_tails.csv',
num_cores = 2)
```
In the above example, *tailfindr* returns a tibble containing the tail data which is then stored in the variable `df`. tailfindr also saves this dataframe as a csv file (`rna_tails.csv`) in the user-specified `save_dir`, which in this case is set to `~/Downloads`. A logfile is also saved in the `save_dir`. The parameter `num_cores` can be increased depending on the number of *physical* cores at your disposal.
#### 2. Plotting the tail
Additionally, *tailfindr* allows you to generate plots that show the tail location in the raw squiggle. You can save these plots as interactive `.html` files by using `'rbokeh'` as the `plotting_library`. You can zoom in on the tail region in the squiggle and see the exact location of the tail.
Give below is a minimal use case in which we will run tailfindr on example cDNA reads present in the tailfindr package, and also save the plots:
```{r, message = FALSE, eval = FALSE}
df <- find_tails(fast5_dir = system.file('extdata', 'cdna', package = 'tailfindr'),
save_dir = '~/Downloads',
csv_filename = 'cdna_tails.csv',
num_cores = 2,
save_plots = TRUE,
plotting_library = 'rbokeh')
```

However, note that generating plots can slow down the performance of tailfindr. We recommend that you generate these plots only for a small subset of your reads.
#### 3. Plotting the tail and debug traces
*tailfindr* can plot additional information that it used while deriving the tail boundaries. Please read our preprint to learn how *tailfindr* works. To plot this information, set the `plot_debug_traces` parameter to `TRUE`.
```{r, message = FALSE, eval = FALSE}
df <- find_tails(fast5_dir = system.file('extdata', 'cdna', package = 'tailfindr'),
save_dir = '~/Downloads',
csv_filename = 'cdna_tails.csv',
num_cores = 2,
save_plots = TRUE,
plot_debug_traces = TRUE,
plotting_library = 'rbokeh')
```

#### 4. Specifying custom basecall group
*tailfindr* needs `Fastq` and `Events/Move` table to work on. By default, it searches for them in the `Basecall_1D_000` group in the Analyses section of the FAST5 file. If for whatever reason, you need *tailfindr* to read data from another basecall group -- lets say `Basecall_1D_001` -- then you can run *tailfindr* as below:
```{r, message = FALSE, eval = FALSE}
df <- find_tails(fast5_dir = system.file('extdata', 'rna_basecall_1D_001', package = 'tailfindr'),
save_dir = '~/Downloads',
csv_filename = 'rna_tails.csv',
num_cores = 2,
basecall_group = 'Basecall_1D_001',
save_plots = TRUE,
plot_debug_traces = TRUE,
plotting_library = 'rbokeh')
```
In this case, the input FAST5 have two basecall groups: `Basecall_1D_000` and `Basecall_1D_001` but we configured *tailfindr* to use `Events/Move` table from the `Basecall_1D_001` group.
There are more options available in the find_tails() function. Please see its [documentation](https://rdrr.io/github/adnaniazi/tailfindr/man/find_tails.html).
#### 5. Specifying custom cDNA primers
If you have used custom front and end primers while designing you cDNA sequences, you can now specify them in *tailfindr*. *tailfindr* will use these sequences instead of the defaults ones to find the orientation of the reads and one of the ends of the poly(A)/(T) tail. Here is how you call *tailfindr* if you have used custom primers:
```{r, message = FALSE, eval = FALSE}
df <- find_tails(fast5_dir = system.file('extdata', 'cdna', package = 'tailfindr'),
save_dir = '~/Downloads/tailfindr_output',
csv_filename = 'cdna_tails.csv',
num_cores = 4,
dna_datatype = 'custom-cdna',
front_primer = "TTTCTGTTGGTGCTGATATTGCTGCCATTACGGCCGG",
end_primer = "ACTTGCCTGTCGCTCTATCTT")
```
Important thing to note here is the use of three additional parameters: `dna_datatype`, `front_primer`, and `end_primer`.
`front_primer` and `end_primer` sequences should always be specified in the 5' to 3' direction.

### Description of the CSV/Dataframe columns
*tailfindr* returns tail data in a dataframe and also saves this information in a user-specified CSV file. The columns generated depend on the whether *tailfindr* was run on RNA or DNA data. Below is a description of columns for both thses scenarios:
##### When input data is RNA
| Column Names | Datatype | Description |
|:---------------|:----------|:-----------------------------------------------------------------------------------------------------------|
| read_id | character | Read ID as given in the Fast5 file |
| tail_start | numeric | Sample index of start site of the tail in raw data |
| tail_end | numeric | Sample index of end site of the tail in raw data |
| samples_per_nt | numeric | Read rate in terms of samples per nucleotide |
| tail_length | numeric | Tail length in nucleotides. It is the difference between `tail_end` and `tail_start` divided by `samples_per_nt` |
| file_path | character | Absolute path of the Fast5 file |
##### When input data is DNA
Here are the columns that you will get from *tailfindr* if you have run it on DNA data:
| Column Names | Datatype | Description |
|----------------|------------------|-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|
| read_id | character | Read ID as given in the Fast5 file |
| read_type | character factor | Whether a read is `"polyA"`, `"polyT"`, or `"invalid"`. Invalid reads are those in which *tailfindr* wasn't able to find Nanopore primers with high confidence. |
| tail_is_valid | logical | Whether a poly(A) tail is a full-length read or not. This is important because a poly(A) tail is at the end of the read, and premature termination of reads is prevelant in cDNA. |
| tail_start | numeric | Sample index of start site of the tail in raw data |
| tail_end | numeric | Sample index of end site of the tail in raw data |
| samples_per_nt | numeric | Read rate in terms of samples per nucleotide |
| tail_length | numeric | Tail length in nucleotides. It is the difference between `tail_end` and `tail_start` divided by `samples_per_nt` |
| file_path | character | Absolute path of the Fast5 file |
## The devil👹 in the details
* tailfindr needs the `Events/Move` table in the FAST5 file to calculate the read-specific normalizer -- `samples_per_nt` -- which is used to convert tail length in samples to tail length in nucleotides. If your data was basecalled with *MinKNOW-Live-Basecalling*, then the Events/Move table might not be saved in the FAST5 file. In such a case, you can rebasecall your reads and adjust the `basecall_group` parameter accordingly when calling `find_tails()` function as demonstrated in the use case # 4 above. This is because now the Events/Move table will now be under `Basecall_1D_001` instead of *tailfindr's* default search location `Basecall_1D_000`. See the figure below: The panel on left shows that the MinKNOW live basecalled read; it has no Event/Move table. The panel on the right shows the same read after it has been re-basecalled using standalone Guppy. Now there is Event/Move table under the freshly-added basaecall group (`Basecall_1D_001`). `find_tails()` should be called with `basecall_group` set to `"Basecall_1D_001"` as shown in the use case # 4 above.

* For DNA data, *tailfindr* decides whether a read is poly(A) or poly(T) based on finding Nanopore primers/adaptors. If you are using the flipflop model to basecall DNA data, please ensure that the nanopore adaptors are not trimmed off while basecalling. This can be done by turning off `enabling_trimming` option in the basecalling script. The script below shows you how we have basecalled our reads using the flipflop model
```{r, engine='bash', message = FALSE, eval = FALSE}
#!/bin/sh
INPUT=/raw/fast5/files/path/
OUTPUT=/output/folder/path/
guppy_basecaller \
--config dna_r9.4.1_450bps_flipflop.cfg \
--input $INPUT \
--save_path $OUTPUT \
--recursive \
--fast5_out \
--hp_correct 1 \
--disable_pings 1 \
--enable_trimming 0
```
* *tailfindr* has been tested and validated using the following sequencing kits:
1. SQK-RNA001 and SQK-RNA002 for RNA
2. SQK-LSK108 and SQK-LSK109 for DNA
3. SQK-PCS110 for PCR cDNA
* *tailfindr* has been tested and validated using the basecallers:
1. Albacore v2.3.1 and v2.3.3.
2. Guppy v2.2.2, v2.3.1, v3.0.1. Guppy v2.2.2, v2.3.1 were tested with flipflop basecalling for DNA, and Guppy v3.0.1 was tested with flipflop basecalling for RNA.
## Want to know more?
We have written a book chapter on how you can use *tailfindr* for transcript isofrom-specific poly(A) tail profiling. It has a detailed protocol and analysis pipeline for processing the data through *tailfindr* .The chapter can be downloaded from [here](https://adnaniazi.com/website-assets/niazi_and_krause_2019_springer_book_chapter.pdf).
## Getting help
If you encounter a clear bug, please file a minimal reproducible example on [github](https://github.com/adnaniazi/tailfindr/issues). Please do provide us a few reads (around 10) so that we can reproduce the problem at our end, and figure out a solution for you.
## Citation
Krause, M., Niazi, A. M., Labun, K., Cleuren, Y. N. T., Müller, F. S., & Valen, E. (2019). *tailfindr*: alignment-free poly(A) length measurement for Oxford Nanopore RNA and DNA sequencing. Rna, 25(10), 1229–1241. doi: 10.1261/rna.071332.119
## License
And of course:
GPL-3: https://www.gnu.org/licenses/gpl-3.0.en.html