https://github.com/althonos/lightmotif
A lightweight platform-accelerated library for biological motif scanning using position weight matrices.
https://github.com/althonos/lightmotif
bioinformatics genomics pssm rust-library sequence-analysis sequence-motif simd
Last synced: 4 months ago
JSON representation
A lightweight platform-accelerated library for biological motif scanning using position weight matrices.
- Host: GitHub
- URL: https://github.com/althonos/lightmotif
- Owner: althonos
- License: mit
- Created: 2023-04-30T20:17:01.000Z (almost 3 years ago)
- Default Branch: main
- Last Pushed: 2025-03-07T12:57:32.000Z (11 months ago)
- Last Synced: 2025-03-29T14:09:25.067Z (11 months ago)
- Topics: bioinformatics, genomics, pssm, rust-library, sequence-analysis, sequence-motif, simd
- Language: Rust
- Homepage:
- Size: 2.39 MB
- Stars: 43
- Watchers: 4
- Forks: 2
- Open Issues: 2
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- License: COPYING
Awesome Lists containing this project
README
# đźđ§Ź `lightmotif` [](https://github.com/althonos/lightmotif/stargazers)
*A lightweight [platform-accelerated](https://en.wikipedia.org/wiki/Single_instruction,_multiple_data) library for [biological motif](https://en.wikipedia.org/wiki/Sequence_motif) scanning using [position weight matrices](https://en.wikipedia.org/wiki/Position_weight_matrix)*.
[](https://github.com/althonos/lightmotif/actions)
[](https://codecov.io/gh/althonos/lightmotif/)
[](https://choosealicense.com/licenses/mit/)
[](https://crates.io/crates/lightmotif)
[](https://docs.rs/lightmotif)
[](https://github.com/althonos/lightmotif/)
[](https://git.embl.de/larralde/lightmotif/)
[](https://github.com/althonos/lightmotif/issues)
[](https://github.com/althonos/lightmotif/blob/master/CHANGELOG.md)
## đşď¸ Overview
[Motif](https://en.wikipedia.org/wiki/Sequence_motif) scanning with
[position weight matrices](https://en.wikipedia.org/wiki/Position_weight_matrix)
(also known as position-specific scoring matrices) is a robust method for
identifying motifs of fixed length inside a
[biological sequence](https://en.wikipedia.org/wiki/Sequence_(biology)). They can be
used to identify [transcription factor](https://en.wikipedia.org/wiki/Transcription_factor)
[binding sites in DNA](https://en.wikipedia.org/wiki/DNA_binding_site),
or [protease](https://en.wikipedia.org/wiki/Protease) [cleavage](https://en.wikipedia.org/wiki/Proteolysis) site in [polypeptides](https://en.wikipedia.org/wiki/Proteolysis).
Position weight matrices are often viewed as [sequence logos](https://en.wikipedia.org/wiki/Sequence_logo):
[](https://www.prodoric.de/matrix/MX000274.html)
The `lightmotif` library provides a Rust crate to run very efficient
searches for a motif encoded in a position weight matrix. The position
scanning combines several techniques to allow high-throughput processing
of sequences:
- Compile-time definition of alphabets and matrix dimensions.
- Sequence symbol encoding for fast table look-ups, as implemented in
HMMER[\[1\]](#ref1) or MEME[\[2\]](#ref2)
- Striped sequence matrices to process several positions in parallel,
inspired by Michael Farrar[\[3\]](#ref3).
- Vectorized matrix row look-up using `permute` instructions of [AVX2](https://fr.wikipedia.org/wiki/Advanced_Vector_Extensions).
- High-throughput Gibbs sampler[\[4\]](#ref4) implementation in *oops*
and *zoops* modes, featuring deterministic results using randomness from
the [`rand`](https://crates.io/rand) crate.
Other crates from the ecosystem provide additional features if needed:
- [`lightmotif-io`](https://crates.io/crates/lightmotif-io) is a crate with parser implementations for various count matrix, frequency matrix and position-specific scoring matrix formats such as [TRANSFAC](https://en.wikipedia.org/wiki/TRANSFAC) or [JASPAR](https://jaspar.elixir.no/docs/).
- [`lightmotif-tfmpvalue`](https://crates.io/crates/lightmotif-tfmpvalue) is an exact reimplementation of the TFM-PVALUE[\[5\]](#ref5) algorithm for converting between a score and a *p*-value for a given scoring matrix.
*This is the Rust version, there is a [Python package](https://pypi.org/project/lightmotif) available as well.*
## đĄ Example
```rust
use lightmotif::*;
use lightmotif::abc::Nucleotide;
// Create a count matrix from an iterable of motif sequences
let counts = CountMatrix::::from_sequences(
["GTTGACCTTATCAAC", "GTTGATCCAGTCAAC"]
.into_iter()
.map(|s| EncodedSequence::encode(s).unwrap()),
)
.unwrap();
// Create a PSSM with 0.1 pseudocounts and uniform background frequencies.
let pssm = counts.to_freq(0.1).to_scoring(None);
// Use the pipeline to encode the target sequence into a striped matrix
let seq = "ATGTCCCAACAACGATACCCCGAGCCCATCGCCGTCATCGGCTCGGCATGCAGATTCCCAGGCG";
let encoded = EncodedSequence::encode(seq).unwrap();
let mut striped = encoded.to_striped();
// Organize layout of striped matrix to allow scoring with PSSM.
striped.configure(&pssm);
// Compute scores for every position of the matrix.
let scores = pssm.score(&striped);
// Scores can be extracted into a Vec, or indexed directly.
let v = scores.unstripe();
assert_eq!(scores[0], -23.07094);
assert_eq!(v[0], -23.07094);
// Find the highest scoring position.
let best = scores.argmax().unwrap();
assert_eq!(best, 18);
// Find the positions above an absolute score threshold.
let indices = scores.threshold(10.0);
assert_eq!(indices, []);
```
This example uses a dynamic dispatch pipeline, which selects the best available
backend (AVX2, SSE2, NEON, or a generic implementation) depending on the local
platform.
## âąď¸ Benchmarks
Both benchmarks use the [MX000001](https://www.prodoric.de/matrix/MX000001.html)
motif from [PRODORIC](https://www.prodoric.de/)[\[5\]](#ref5), and the
[complete genome](https://www.ncbi.nlm.nih.gov/nuccore/U00096) of an
*Escherichia coli K12* strain.
*Benchmarks were run on a [i7-10710U CPU](https://ark.intel.com/content/www/us/en/ark/products/196448/intel-core-i7-10710u-processor-12m-cache-up-to-4-70-ghz.html) running @1.10GHz, compiled with `--target-cpu=native`*.
- Score every position of the genome with the motif weight matrix:
```console
test bench_avx2 ... bench: 4,510,794 ns/iter (+/- 9,570) = 1029 MB/s
test bench_sse2 ... bench: 26,773,537 ns/iter (+/- 57,891) = 173 MB/s
test bench_generic ... bench: 317,731,004 ns/iter (+/- 2,567,370) = 14 MB/s
```
- Find the highest-scoring position for a motif in a 10kb sequence
(compared to the PSSM algorithm implemented in
[`bio::pattern_matching::pssm`](https://docs.rs/bio/1.1.0/bio/pattern_matching/pssm/index.html)):
```console
test bench_avx2 ... bench: 12,797 ns/iter (+/- 380) = 781 MB/s
test bench_sse2 ... bench: 62,597 ns/iter (+/- 43) = 159 MB/s
test bench_generic ... bench: 671,900 ns/iter (+/- 1,150) = 14 MB/s
test bench_bio ... bench: 1,193,911 ns/iter (+/- 2,519) = 8 MB/s
```
## đ Feedback
### â ď¸ Issue Tracker
Found a bug ? Have an enhancement request ? Head over to the [GitHub issue
tracker](https://github.com/althonos/lightmotif/issues) if you need to report
or ask something. If you are filing in on a bug, please include as much
information as you can about the issue, and try to recreate the same bug
in a simple, easily reproducible situation.
## đ Changelog
This project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.html)
and provides a [changelog](https://github.com/althonos/lightmotif/blob/master/CHANGELOG.md)
in the [Keep a Changelog](http://keepachangelog.com/en/1.0.0/) format.
## âď¸ License
This library is provided under the open-source
[MIT license](https://choosealicense.com/licenses/mit/).
*This project was developed by [Martin Larralde](https://github.com/althonos/)
during his PhD project at the [European Molecular Biology Laboratory](https://www.embl.de/)
in the [Zeller team](https://github.com/zellerlab).*
## đ References
- \[1\] Eddy, Sean R. âAccelerated Profile HMM Searchesâ. PLOS Computational Biology 7, no. 10 (20 October 2011): e1002195. [doi:10.1371/journal.pcbi.1002195](https://doi.org/10.1371/journal.pcbi.1002195).
- \[2\] Grant, Charles E., Timothy L. Bailey, and William Stafford Noble. âFIMO: Scanning for Occurrences of a given Motifâ. Bioinformatics 27, no. 7 (1 April 2011): 1017â18. [doi:10.1093/bioinformatics/btr064](https://doi.org/10.1093/bioinformatics/btr064).
- \[3\] Farrar, Michael. âStriped SmithâWaterman Speeds Database Searches Six Times over Other SIMD Implementationsâ. Bioinformatics 23, no. 2 (15 January 2007): 156â61. [doi:10.1093/bioinformatics/btl582](https://doi.org/10.1093/bioinformatics/btl582).
- \[4\] Lawrence, Charles E., Stephen F. Altschul, Mark S. Boguski, Jun S. Liu, Andrew F. Neuwald, and John C. Wootton. âDetecting subtle sequence signals: a Gibbs sampling strategy for multiple alignmentâ. Science. 1993 Oct 8;262(5131):208-14. [doi:10.1126/science.8211139](https://doi.org/10.1126/science.8211139).
- \[5\] Touzet, HĂŠlène, and Jean-StĂŠphane VarrĂŠ. âEfficient and Accurate P-Value Computation for Position Weight Matricesâ. Algorithms for Molecular Biology 2, no. 1 (2007): 1â12. [doi:10.1186/1748-7188-2-15](https://doi.org/10.1186/1748-7188-2-15).
- \[6\] Dudek, Christian-Alexander, and Dieter Jahn. âPRODORIC: State-of-the-Art Database of Prokaryotic Gene Regulationâ. Nucleic Acids Research 50, no. D1 (7 January 2022): D295â302. [doi:10.1093/nar/gkab1110](https://doi.org/10.1093/nar/gkab1110).