An open API service indexing awesome lists of open source software.

https://github.com/applicativesystem/go-telomeres-graph

kmer density based telomeres searching and profling
https://github.com/applicativesystem/go-telomeres-graph

bioinformatics genome-analysis genome-annotation reassembly telomere telomeres telomeric

Last synced: 2 months ago
JSON representation

kmer density based telomeres searching and profling

Awesome Lists containing this project

README

        

# go-teleomeres-graph

- searching telomeres across the plant and human genome across tree of life for reassembly of those telomere specific regions.
- a kmer based approach to search for the matching telomere and then extract the upstream and the downstream of the matching telomere for reassembly of those regions.
- the tolkit version is present here [tolkit](https://github.com/tolkit/telomeric-identifier), which only plots the kmers and not tell where to look and doesnt provide support for reassembly.
- the clade specific sets are also present in this repository, which are used in the tolkit for the search.
- tolkit doesnt allow for the telomere extraction for re-assembly and go-telomeres-graph provide that.

```
gauavsablok@gauravsablok ~/Desktop/codecreatede/golang/go-telomeres-graph ±main⚡ » \
go run main.go -h
This analyzes and reports the telomeres and the corresponding upstream and the downstream from the match telomeres

Usage:
telomeres [flags]

Flags:
-D, --downstream sequence int downstream sequence (default 10)
-F, --fastaid string sequence selection for teleomere (default "id of the fasta sequence that you want to look for the telomere")
-G, --genome fasta string fasta genome (default "genome file in fasta format")
-h, --help help for telomeres
-I, --kmersize telomere int telomer kmder define (default 4)
-T, --telomere to search for string teomere search space (default "string for the telomere")
-U, --upstream sequence int upstream region for the seqence (default 10)
exit status 1
gauavsablok@gauravsablok ~/Desktop/codecreatede/golang/go-telomeres-graph ±main⚡ »
go run main.go -G fastafile.fasta -F chr10:66478458-66505490 -T ATCGG
ATCGG 33 38
GCCCAATGAC - upstream
CGTGTCTAGC - downstream
GCCCAATGACATCGGCGTGTCTAGC - upstream and downstream with the telomere included
```

```
gauavsablok@gauravsablok ~/Desktop/codecreatede/golang/go-telomeres-graph ±main⚡ »
./telomeres -h
This analyzes and reports the telomeres and the corresponding upstream and the downstream from the match telomeres

Usage:
telomeres [flags]

Flags:
-D, --downstream sequence int downstream sequence (default 10)
-F, --fastaid string sequence selection for teleomere (default "id of the fasta sequence that you want to look for the telomere")
-G, --genome fasta string fasta genome (default "genome file in fasta format")
-h, --help help for telomeres
-T, --telomere to search for string teomere search space (default "string for the telomere")
-U, --upstream sequence int upstream region for the seqence (default 10)
gauavsablok@gauravsablok ~/Desktop/codecreatede/golang/go-telomeres-graph ±main⚡ »
./telomeres -G fastafile.fasta -F chr10:66478458-66505490 -T ATCGG
GCCCAATGAC
CGTGTCTAGC
GCCCAATGACATCGGCGTGTCTAGC
```
```
wxr-xr-x. 1 gauavsablok gauavsablok 40 Oct 14 14:58 clades
-rw-r--r--. 1 gauavsablok gauavsablok 13 Oct 15 13:51 downstream.fasta
-rwxr-xr-x. 1 gauavsablok gauavsablok 148 Oct 15 11:38 fastafile.fasta
drwxr-xr-x. 1 gauavsablok gauavsablok 164 Oct 15 13:51 .git
-rw-r--r--. 1 gauavsablok gauavsablok 204 Oct 15 09:49 go.mod
-rw-r--r--. 1 gauavsablok gauavsablok 896 Oct 15 09:49 go.sum
-rw-r--r--. 1 gauavsablok gauavsablok 4658 Oct 15 13:49 main.go
-rw-r--r--. 1 gauavsablok gauavsablok 3081 Oct 15 13:53 README.md
-rw-r--r--. 1 gauavsablok gauavsablok 28 Oct 15 13:51 reassemble.fasta
-rwxr-xr-x. 1 gauavsablok gauavsablok 5480185 Oct 15 13:51 telomeres
-rw-r--r--. 1 gauavsablok gauavsablok 5488640 Oct 15 13:52 telomeres.tar
-rw-r--r--. 1 gauavsablok gauavsablok 161 Oct 15 13:51 telomeres.txt
-rw-r--r--. 1 gauavsablok gauavsablok 13 Oct 15 13:51 upstream.fasta
```
Gaurav Sablok