https://github.com/astrodynamic/dna_analazer-algorithms-for-working-with-text-in-cpp

This project implements substring search and sequence alignment algorithms for molecular sequences analysis. It includes the Rabin-Karp algorithm for substring search and the Needleman-Wunsch algorithm for sequence alignment. Developed in C++17, the code follows Google Style and includes a Makefile for building and testing the program.
https://github.com/astrodynamic/dna_analazer-algorithms-for-working-with-text-in-cpp

algorithms analayze cmake cmakelists console-application console-applications cpp cpp17 dna dna-sequences hashing learning makefile rabin-karp-algorithm regex reusable testing text-algorithms text-summarization

Last synced: 19 days ago
JSON representation

This project implements substring search and sequence alignment algorithms for molecular sequences analysis. It includes the Rabin-Karp algorithm for substring search and the Needleman-Wunsch algorithm for sequence alignment. Developed in C++17, the code follows Google Style and includes a Makefile for building and testing the program.

• Host: GitHub
• URL: https://github.com/astrodynamic/dna_analazer-algorithms-for-working-with-text-in-cpp
• Owner: Astrodynamic
• License: mit
• Created: 2023-04-12T15:02:47.000Z (over 2 years ago)
• Default Branch: develop
• Last Pushed: 2023-05-09T16:10:11.000Z (over 2 years ago)
• Last Synced: 2025-04-03T03:51:12.703Z (6 months ago)
• Topics: algorithms, analayze, cmake, cmakelists, console-application, console-applications, cpp, cpp17, dna, dna-sequences, hashing, learning, makefile, rabin-karp-algorithm, regex, reusable, testing, text-algorithms, text-summarization
• Language: C++
• Homepage:
• Size: 870 KB
• Stars: 4
• Watchers: 1
• Forks: 1
• Open Issues: 0
• Metadata Files:
  • Readme: README.md
  • License: LICENSE

Awesome Lists containing this project

README

          
# Text Algorithms in CPP

Text Algorithms is a C++ project that implements substring search and sequence alignment algorithms. This project can be useful for bioinformatics and other full-text search tasks.

## Dependencies

The project requires the following dependencies:

- CMake >= 3.15

- C++17-compatible compiler

## Build

To build the project, follow these steps:

1. Clone the repository:

```bash

git clone https://github.com/your-username/TextAlgorithms.git

```

2. Navigate to the project directory:

```bash

cd TextAlgorithms

```

3. Run the following commands:

```bash

cmake -S . -B ./build

cmake --build ./build

```

## Usage



### Substring Search

The project implements the Rabin-Karp algorithm for substring search. To use it, include the `SubstringSearch.h` header and call the `rabinKarp` function with the haystack and needle strings:

```cpp

#include "SubstringSearch.h"

// ...

std::string haystack = "Madam, I'm Adam";

std::string needle = "am";

std::vector matches = rabinKarp(haystack, needle);

// matches contains the positions of the needle occurrences in the haystack

```

### Sequence Alignment

The project implements the Needleman-Wunsch algorithm for sequence alignment. To use it, include the `SequenceAlignment.h` header and call the `needlemanWunsch` function with the two sequences and the similarity matrix:

```cpp

#include "SequenceAlignment.h"

// ...

std::string seq1 = "GGGCGACACTCCACCATAGA";

std::string seq2 = "GGCGACACCCACCATACAT";

std::vector alignment = needlemanWunsch(seq1, seq2, similarityMatrix);

// alignment contains the two sequences aligned with gaps

```

## Examples

### Substring Search

Find all occurrences of the string "AAGCCTCTCAAT" in the HIV virus sequence:

```cpp

#include "SubstringSearch.h"

#include 

#include 

int main() {

  std::ifstream file("HIV.txt");

  std::string haystack((std::istreambuf_iterator(file)), std::istreambuf_iterator());

  std::string needle = "AAGCCTCTCAAT";

  std::vector matches = rabinKarp(haystack, needle);

  for (int match : matches) {

    std::cout << "Match at position " << match << std::endl;

  }

  return 0;

}

```

### Sequence Alignment

Align two DNA sequences using a similarity matrix:

```cpp

#include "SequenceAlignment.h"

#include 

int main() {

  std::string seq1 = "GGGCGACACTCCACCATAGA";

  std::string seq2 = "GGCGACACCCACCATACAT";

  std::vector alignment = needlemanWunsch(seq1, seq2, similarityMatrix);

  std::cout << alignment[0] << std::endl << alignment[1] << std::endl;

  return 0;

}

```

### Matching regular expressions

The program checks whether a sequence over the alphabet `{A, C, G, T}` matches a regular expression. \

The input of the program is a file with *two* lines. The first line contains the sequence to be checked for a match. The second line contains a pattern that includes characters from the alphabet and the following characters:

- `.` -- matches any single character from the alphabet;

- `?` -- matches any single character from the alphabet or the absence of a character;

- `+` -- matches zero or more repetitions of the previous element;

- `*` -- matches any sequence of characters from the alphabet or the absence of characters.

The output of the program is *True*/*False* - whether the given sequence matches the pattern.

Example input:

```

GGCGACACCCACCATACAT

G?G*AC+A*A.

```

Example output:

```

True

```

### K-similar strings

Strings s1 and s2 are k-similar (for some non-negative integer *k*) if it is possible to swap two letters in s1 exactly *k* times so that the resulting string is equal to s2.

The program checks k-similarity of two sequences over the alphabet `{A, C, G, T}`. \

The input of the program is a file with *two* lines. The output of the program is the smallest *k* for which s1 and s2 are k-similar. If the strings are not anagrams, print an error message.

Example input:

```

GGCGACACC

AGCCGCGAC

```

Example output:

```

3

```

### Minimum Window Substring

A program for finding the minimum window substring for a sequence over the alphabet `{A, C, G, T}`.

The input to the program is a file containing *two* lines: s and t. A window substring of string s is a substring that contains all characters present in string t (including duplicates).

The output of the program is the minimum length window substring. If there is no window substring, return an empty string.

Example input:

```

GGCGACACCCACCATACAT

TGT

```

Example output:

```

GACACCCACCATACAT

```

## License

This project is licensed under the terms of the MIT license. See [LICENSE](LICENSE) for more information.