https://github.com/averissimo/mass-blast
Workflow to accelerate the annotation of unkown coding sequences
https://github.com/averissimo/mass-blast
bioinformatics blast fasta
Last synced: 7 months ago
JSON representation
Workflow to accelerate the annotation of unkown coding sequences
- Host: GitHub
- URL: https://github.com/averissimo/mass-blast
- Owner: averissimo
- License: gpl-3.0
- Created: 2014-09-23T11:03:26.000Z (about 11 years ago)
- Default Branch: master
- Last Pushed: 2017-10-05T23:36:27.000Z (about 8 years ago)
- Last Synced: 2025-02-08T18:11:58.079Z (8 months ago)
- Topics: bioinformatics, blast, fasta
- Language: Ruby
- Homepage: https://averissimo.github.io/mass-blast
- Size: 17.8 MB
- Stars: 1
- Watchers: 3
- Forks: 0
- Open Issues: 1
-
Metadata Files:
- Readme: README.md
- License: LICENSE
Awesome Lists containing this project
README
MassBLAST
==========
Command line application to perform BLAST queries from multiple files against different databases at once.
[Official site](https://averissimo.github.io/mass-blast)
[Download latest here](https://github.com/averissimo/mass-blast/releases/latest).
A pre-print of the manuscript describing this application is available at bioRxiv and can be [accessed here](https://www.biorxiv.org/content/early/2017/07/03/131953).
*General description of the MassBlast workflow:*
[](docs/pipeline.png)
## Install
1. Download BLAST+ and MassBlast from the links in the table below
1. BLAST+ must be installed and available from a command line
- *check by running the command:* `blastn -version`
1. Decompress MassBlast and it is ready to be used using the `mass-blast` script
Software name | Windows | Mac OS X | Linux |
------------- | ------------- | -------- | ------|
MassBlast *downloads* | [Download](https://github.com/averissimo/mass-blast/releases/download/v0.9.13/mass-blast-0.9.13-win32.zip) | [Download](https://github.com/averissimo/mass-blast/releases/download/v0.9.13/mass-blast-0.9.13-osx.tar.gz) | [Download](https://github.com/averissimo/mass-blast/releases/download/v0.9.13/mass-blast-0.9.13-linux-x86_64.tar.gz)
BLAST+ (pre-requirement)| [v2.2.30 (32-bit)](https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-win32.exe) | [v2.6.0](https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.6.0/ncbi-blast-2.6.0+-x64-macosx.tar.gz) | [2.6.0](https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.6.0/ncbi-blast-2.6.0+-x64-linux.tar.gz)
*BLAST+ important notes*
1. Must be installed before MassBlast is run
1. *Windows users*
1. Must install [*32-bit* version *v2.2.30* of BLAST+](https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/2.2.30/ncbi-blast-2.2.30+-win32.exe)
1. In case of an error in the first run:
- Delete `ncbi.ini` located at a subdirectory at the `AppData` folder in the user directory
- If problem persists, [submit an issue](https://github.com/averissimo/mass-blast/issues).
1. *Mac OS X* and *Linux users*
- MassBlast was tested with version 2.6.0, but it could work with more recent versions *(or older and down to v2.2.30)*
*note:* Ruby and all other requirements are included in the package files, it is not necessary to install *when using packaged version*.
### How to use MassBlast?
- Place fasta files with queries at `db_and_queries/queries` folder.
- You can have as many files as needed, see below for an example of a nucleic-acid query
- Place blast databases at `db_and_queries/db` folder.
- Check "How to setup a Blast database for a transcriptome" below for more information on creating a Blast database.
- Edit user.yml file to change options and BLAST engine to be used, check `user.yml.example` for more information.
- run mass-blast script *(either double click it on Windows or as a command in the command line.*
Example of a nucleic-acid query file that could be placed in `db_and_queries/queries` folder:
```
>Example01
attgggaatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtgggct
gaggagt
>Example03
attgggaatttactgcaactcaaggagaagaaaccctaccagactttt
>Example02
attgggaatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtgggct
gaggagtatttactgcaactcaaggagaagaaaccctaccagacttttacaaggtggtgg
gcaactcaagcaactcaagcaactcaagcaactcaa
```
## Install and usage (from source code)
We do not recommend installing from source unless you plan to develop MassBlast further. The package available already has all dependencies pre-packaged and is ready to be used.
Requirements:
- Ruby interpreter
- Bundler gem
- rub `bundle install` at root directory
- Options are configurable via `config/user.yml` file
- Change 'db_parent' and 'query_parent' to specify the parent directories for blast databases and queries
- Change 'dbs' and 'folder_queries' to specify the databases that should be used and which query folders should be crawled
$ ruby script.rb
### External data
The test blast database and the taxonomy database are not kept in the git tree anymore, to get this auxiliary data run the command below or call mass-blast via script.rb
$ rake bootstrap.rb
If you need to include it on your code use:
require_relative 'src/download'
ExternalData.download(path_to_db_parent)
### How to test it
$ rake spec
### Type of BLAST methods available
The method is defined in the file `user.yml`
- BLASTn: Nucleic-acid sequences against a nucleic-acid database
- TBLASTn: Protein sequences against a nucleic-acid database (dynamically translated to amino-acid sequences in all six reading frames)
- TBLASTx: Nucleic-acid sequences against nucleic-acid database, where both query and database are dynamically translated to amino-acid sequences into all six reading frames
### Methods available
All different types have two implemented methods, blast and blast_folders
- blast(qfile, db, out_file, query_parent=nil, db_parent=nil)
- *qfile*: query file path - string
- *db*: database name - string
- *out_file*: output file path (can be relative) -string
- *query_parent*: parent directory of query (optional) - string
- *db_parent*: parent directory of database (optional) - string
*notes:* '*qfile*' and '*db*' arguments can be relative to '*query_parent*' and '*db_parent*' (respectively).
- blast_folders( folders=nil, query_parent=nil, db_parent=nil )
- *folders*: list of folders (optional) - array of strings
- *query_parent*: parent directory of folders (optional) - string
- *db_parent*: parent directory of database (optional) - string
*notes:* '*folder*' argument can be relative to '*query_parent*'. All optional parameters must be set in the config.yml file
### How to setup a Blast database for a transcriptome
Using makeblastdb command that comes bundled with Blast+
- Open the command line in your operating system
- Navigate to directory
- Go to directory that has the fasta file with the assembly
- Run makeblastdb command in that directory
- nucleic-acids database
`$ makeblastdb -in -dbtype nucl -out "" -title ""`
- protein database
`$ makeblastdb -in -dbtype nucl -out "" -title ""`
*note:* do to not use spaces in the <blast db new name>
#### Quickly setup databases
Place the fasta files for the database in db_and_queries/import_dbs directory and run the appropriate script.
You also need to say if it is a nucleic-acid or protein-based fasta file.
For Linux and Mac OS X run the `import_fastas.sh` script
```
$ cd db_and_queries/import_dbs
# for nucleic-acid
$ sh import_fastas.sh nucl
# for protein
$ sh import_fastas.sh prot
```
For Windows run the `import_fastas.bat` script
```
$ cd db_and_queries/import_dbs
# for nucleic-acid
$ import_fastas.bat nucl
# for protein
$ import_fastas.bat prot
```
### Related Tools
- [ORF-Finder](http://github.com/averissimo/orf_finder): Finds the longest Open Reading Frame from a nucleic-acid sequence
- [BioRuby](http://bioruby.org/): Open source bioinformatics library for Ruby
- [Gene Extractor](https://github.com/averissimo/gene-extractor/): can be used to extract genes from Kegg2 and GenBank using keyword search
- [MassBlast package bundler](https://github.com/averissimo/app-mass-blast): Creates a package that can be easily used in all main Operating Systems without having to install Ruby and any Ruby dependecies
## Ackowledgements
MassBlast was developed primarily by *[André Veríssimo](http://web.tecnico.ulisboa.pt/andre.verissimo/)*, *Jean-Etienne Bassard* and *[Susana Vinga](http://web.tecnico.ulisboa.pt/susanavinga/)*
A pre-print of the manuscript is available at bioRxiv and can be [accessed here](https://www.biorxiv.org/content/early/2017/07/03/131953)
This work was supported by:
- European Union Framework Program 7, Project [BacHBERRY](www.bachberry.eu) *(FP7-613793)*;
- [FCT](www.fct.pt), through IDMEC, under LAETA, projects *(UID/EMS/50022/2013)*;
- Susana Vinga acknowledges support by program
Investigador FCT *(IF/00653/2012)* from [FCT](www.fct.pt), co-funded by the European Social Fund *(ESF)* through the Operational Program Human Potential *(POPH)*;
- André Veríssimo acknowledges support from [FCT](www.fct.pt) *(SFRH/BD/97415/2013)*.
We would like to thank *Cathie Martin* and *Philippe Vain* for reading the manuscript and providing us
with important comments and insights. We would also like to thank *Aldo Ricardo Almeida Robles* and *Nuno Mira* for testing MassBlast.