https://github.com/averissimo/orf_finder
Finds the longest orfs in a nucleotide sequence.
https://github.com/averissimo/orf_finder
Last synced: 11 months ago
JSON representation
Finds the longest orfs in a nucleotide sequence.
- Host: GitHub
- URL: https://github.com/averissimo/orf_finder
- Owner: averissimo
- License: gpl-3.0
- Created: 2016-01-11T19:41:00.000Z (over 10 years ago)
- Default Branch: master
- Last Pushed: 2016-06-24T14:19:56.000Z (almost 10 years ago)
- Last Synced: 2025-06-03T07:01:18.981Z (about 1 year ago)
- Language: Ruby
- Size: 29.3 KB
- Stars: 2
- Watchers: 2
- Forks: 0
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
- License: LICENSE
Awesome Lists containing this project
README
# ORF-Finder
**Website**: [http://sels.tecnico.pt/orf_finder](http://sels.tecnico.pt/orf_finder/)
ORF-Finder is a library that finds the longest Open Reading Frame (ORF) from a nucleotide sequence.
It will search the sequence for existing start and stop codons and return a single ORF for each frame.
When there is not a ORF present with any of the configurated start and stop codons, then it fallbacks to:
- Using the first codon of the sequence when:
- No start codon is present;
- The lenght of an ORF is shorter than the minimum option;
- Using the last codon of the sequence when:
- No stop codon is present.
note: this was developed in parallell with [mass-blast](http://github.com/averissimo/mass-blast) and due to the lack of a Ruby library that had this functionality.
# Installation
ORF-Finder can be installed from RubyGems.org by:
gem install orf_finder
or adding to the [Gemfile](http://bundler.io/gemfile.html):
gem 'orf_finder'
or adding directly from the github repository:
gem 'orf_finder', github: 'averissimo/orf_finder'
# Usage
There are two classes that can be used to search for ORF,
- ORFinder: can look at both the direct sequence or the complement.
my_orf = ORFFinder.new('aaaatgaaaaaaatgtaaaaa', min: 3)
my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement
- ORF: only looks at the direct string.
my_orf = ORF.new('aaaatgaaaaaaatgtaaaaa', min: 3)
my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement
# Options
- 'start': list of strings
- Defines the allowed start codons
- 'stop': list of strings
- Defines the allowed stop codons
- 'reverse': true/false
- Whether it should look at the complement
- 'direct': true/false
- Whether it should look at the direct sequence (as is)
- 'min': integer
- Minimum length for an ORF to be considered
- 'debug': true/false
- Whether or not to create an log file
# Ackowledgements
This tool was created as a part of [FCT](www.fct.p) grant SFRH/BD/97415/2013 and European Commission research project [BacHBerry](www.bachberry.eu) (FP7- 613793)
[Developer](http://web.tecnico.ulisboa.pt/andre.verissimo/)