An open API service indexing awesome lists of open source software.

https://github.com/averissimo/orf_finder

Finds the longest orfs in a nucleotide sequence.
https://github.com/averissimo/orf_finder

Last synced: about 1 year ago
JSON representation

Finds the longest orfs in a nucleotide sequence.

Awesome Lists containing this project

README

          

# ORF-Finder

**Website**: [http://sels.tecnico.pt/orf_finder](http://sels.tecnico.pt/orf_finder/)

ORF-Finder is a library that finds the longest Open Reading Frame (ORF) from a nucleotide sequence.

It will search the sequence for existing start and stop codons and return a single ORF for each frame.

When there is not a ORF present with any of the configurated start and stop codons, then it fallbacks to:
- Using the first codon of the sequence when:
- No start codon is present;
- The lenght of an ORF is shorter than the minimum option;
- Using the last codon of the sequence when:
- No stop codon is present.

note: this was developed in parallell with [mass-blast](http://github.com/averissimo/mass-blast) and due to the lack of a Ruby library that had this functionality.

# Installation

ORF-Finder can be installed from RubyGems.org by:

gem install orf_finder

or adding to the [Gemfile](http://bundler.io/gemfile.html):

gem 'orf_finder'

or adding directly from the github repository:

gem 'orf_finder', github: 'averissimo/orf_finder'

# Usage

There are two classes that can be used to search for ORF,
- ORFinder: can look at both the direct sequence or the complement.

my_orf = ORFFinder.new('aaaatgaaaaaaatgtaaaaa', min: 3)
my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement

- ORF: only looks at the direct string.

my_orf = ORF.new('aaaatgaaaaaaatgtaaaaa', min: 3)
my_orf.nt # returns the longests ORFs for all reading frames as a nucleotide sequence, both the direct and complement
my_orf.nt # returns the longests ORFs for all reading frames as an amino-acid sequence, both the direct and complement

# Options

- 'start': list of strings
- Defines the allowed start codons
- 'stop': list of strings
- Defines the allowed stop codons
- 'reverse': true/false
- Whether it should look at the complement
- 'direct': true/false
- Whether it should look at the direct sequence (as is)
- 'min': integer
- Minimum length for an ORF to be considered
- 'debug': true/false
- Whether or not to create an log file

# Ackowledgements

This tool was created as a part of [FCT](www.fct.p) grant SFRH/BD/97415/2013 and European Commission research project [BacHBerry](www.bachberry.eu) (FP7- 613793)

[Developer](http://web.tecnico.ulisboa.pt/andre.verissimo/)