https://github.com/bcgsc/nthash
Fast hash function for DNA/RNA sequences
https://github.com/bcgsc/nthash
bioinformatics bloom-filter genomics hash hash-algorithm hash-methods k-mer-hashing
Last synced: 7 months ago
JSON representation
Fast hash function for DNA/RNA sequences
- Host: GitHub
- URL: https://github.com/bcgsc/nthash
- Owner: bcgsc
- License: mit
- Created: 2015-05-15T18:44:10.000Z (over 10 years ago)
- Default Branch: master
- Last Pushed: 2024-04-15T17:20:07.000Z (over 1 year ago)
- Last Synced: 2025-04-15T18:17:23.301Z (7 months ago)
- Topics: bioinformatics, bloom-filter, genomics, hash, hash-algorithm, hash-methods, k-mer-hashing
- Language: C++
- Homepage: http://bcgsc.github.io/ntHash/
- Size: 12.3 MB
- Stars: 100
- Watchers: 19
- Forks: 13
- Open Issues: 4
-
Metadata Files:
- Readme: README.md
- License: LICENSE
- Citation: CITATION.bib
Awesome Lists containing this project
README
[](https://github.com/bcgsc/ntHash/releases)
[](https://github.com/bcgsc/ntHash/archive/master.zip)
[](https://github.com/bcgsc/ntHash/issues)

ntHash is an efficient rolling hash function for k-mers and spaced seeds.
# Installation
Make sure [Meson](https://mesonbuild.com/) is installed on the system.
Download the repo (either from the releases section or close using `git clone https://github.com/bcgsc/ntHash`). Setup meson in an arbitrary directory (e.g. `build`), by running the following command in the project's root (include `--prefix=PREFIX` set the installation prefix to `PREFIX`):
```shell
meson setup --buildtype=release --prefix=PREFIX build
```
Then, install the project and its dependencies using:
```shell
meson install -C build
```
This will install `include/nthash` and `lib/libnthash.a` to the installation prefix.
# Usage
To use ntHash in a C++ project:
- Import ntHash in the code using `#include `
- Access ntHash classes from the `nthash` namespace
- Add the `include` directory (pass `-IPREFIX/include` to the compiler)
- Link the code with `libnthash.a` (i.e. pass `-LPREFIX/lib -lnthash` to the compiler, where `PREFIX` is the installation prefix)
- Compile your code with `-std=c++17` (and preferably `-O3`) enabled
Refer to [docs](https://bcgsc.github.io/ntHash/) for more information.
# Examples
Generally, the `nthash::NtHash` and `nthash::SeedNtHash` classes are used for hashing sequences:
```C++
nthash::NtHash nth("TGACTGATCGAGTCGTACTAG", 1, 5); // 1 hash per 5-mer
while (nth.roll()) {
// use nth.hashes() for canonical hashes
// nth.get_forward_hash() for forward strand hashes
// nth.get_reverse_hash() for reverse strand hashes
}
```
```C++
std::vector seeds = {"10101", "11011"};
nthash::SeedNtHash nth("TGACTGATCGAGTCGTACTAG", seeds, 3, 5);
while (nth.roll()) {
// nth.hashes()[0] = "T#A#T"'s first hash
// nth.hashes()[1] = "T#A#T"'s second hash
// nth.hashes()[2] = "T#A#T"'s third hash
// nth.hashes()[3] = "TG#CT"'s first hash
}
```
# For developers
If you would like to contribute to the development of ntHash, after forking/cloning the repo, create the `build` directory without the release flag:
```
meson setup build
```
Compile the code, tests, and benchmarking script using:
```
meson compile -C build
```
If compilation is successful, `libnthash.a` will be available in the `build` folder. The benchmarking script is also compiled as the `bench` binary file in `build`.
Before sending a PR, make sure that:
- tests pass by running `meson test` in the project directory
- code is formatted properly by running `ninja clang-format` in the `build` folder (requires `clang-format` to be available)
- coding standards have been met by making sure running `ninja clang-tidy-check` in `build` returns no errors (requires `clang-tools` to be installed)
- documentation is up-to-date by running `ninja docs` in `build` (requires [doxygen](https://www.doxygen.nl/))
# Publications
Parham Kazemi, Johnathan Wong, Vladimir Nikolić, Hamid Mohamadi, René L Warren, Inanç Birol, ntHash2: recursive spaced seed hashing for nucleotide sequences, Bioinformatics, 2022;, btac564, [https://doi.org/10.1093/bioinformatics/btac564](https://doi.org/10.1093/bioinformatics/btac564)
Hamid Mohamadi, Justin Chu, Benjamin P Vandervalk, and Inanc Birol.
ntHash: recursive nucleotide hashing.
*Bioinformatics* (2016) 32 (22): 3492-3494.
[doi:10.1093/bioinformatics/btw397](http://dx.doi.org/10.1093/bioinformatics/btw397)