An open API service indexing awesome lists of open source software.

https://github.com/dhondta/python-codext

Python codecs extension featuring CLI tools for encoding/decoding anything
https://github.com/dhondta/python-codext

alphabet base base36 base45 base58 base62 braille cli-tools codecs cryptography cryptography-tools ctf ctf-tools decode-strings decoder encoder-decoder encoding encodings infosec python

Last synced: 10 months ago
JSON representation

Python codecs extension featuring CLI tools for encoding/decoding anything

Awesome Lists containing this project

README

          


CodExt Tweet


Encode/decode anything.

[![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
[![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
[![Build Status](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml/badge.svg)](https://github.com/dhondta/python-codext/actions/workflows/python-package.yml)
[![Coverage Status](https://raw.githubusercontent.com/dhondta/python-codext/main/docs/coverage.svg)](#)
[![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
[![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
[![DOI](https://zenodo.org/badge/236679865.svg)](https://zenodo.org/badge/latestdoi/236679865)
[![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)

[**CodExt**](https://github.com/dhondta/python-codext) is a (Python2-3 compatible) library that extends the native [`codecs`](https://docs.python.org/3/library/codecs.html) library (namely for adding new custom encodings and character mappings) and provides **120+ new codecs**, hence its name combining *CODecs EXTension*. It also features a **guess mode** for decoding multiple layers of encoding and **CLI tools** for convenience.

```sh
$ pip install codext
```

Want to contribute a new codec ? | Want to contribute a new macro ?
:----------------------------------:|:------------------------------------:
Check the [documentation](https://python-codext.readthedocs.io/en/latest/howto.html) first
Then [PR](https://github.com/dhondta/python-codext/pulls) your new codec | [PR](https://github.com/dhondta/python-codext/pulls) your updated version of [`macros.json`](https://github.com/dhondta/python-codext/blob/main/codext/macros.json)

## :mag: Demonstrations

Using CodExt from the command line


Using base tools from the command line


Using the unbase command line tool

## :computer: Usage (main CLI tool) Tweet on codext

```session
$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
⠞⠑⠎⠞

$ echo -en "test" | codext encode base100
👫👜👪👫
```

### Chaining codecs

```sh
$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string
```

### Using macros

```sh
$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro
```

## :computer: Usage (base CLI tool) Tweet on unbase

```session
$ echo "Test string !" | base122
*.7!ft9�-f9Â

$ echo "Test string !" | base91
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !
```

```session
$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | unbase -f Test
Test string !
```

## :computer: Usage (Python)

Getting the list of available codecs:

```python
>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'

>>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
'this is a test'

>>> for i in range(8):
print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
f.read()
'this is a test'

>>> codext.decode("""
=
X
:
x
n
r
y
Y
y
p
a
`
n
|
a
o
h
`
g
o
z """, "whitespace-after+before")
'CSC{not_so_invisible}'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
. *
***.*
* .
.*
* .*
. *
** .*
***.**
** .**
.*
* .
* *. *
.*
* *.
* *. *
* .
* *.
* *. *
***.
*.*
***.*
* .*
```

## :page_with_curl: List of codecs

#### [BaseXX](https://python-codext.readthedocs.io/en/latest/enc/base.html)

- [X] `base1`: useless, but for the sake of completeness
- [X] `base2`: simple conversion to binary (with a variant with a reversed alphabet)
- [X] `base3`: conversion to ternary (with a variant with a reversed alphabet)
- [X] `base4`: conversion to quarternary (with a variant with a reversed alphabet)
- [X] `base8`: simple conversion to octal (with a variant with a reversed alphabet)
- [X] `base10`: simple conversion to decimal
- [X] `base11`: conversion to digits with a "*a*"
- [X] `base16`: simple conversion to hexadecimal (with a variant holding an alphabet with digits and letters inverted)
- [X] `base26`: conversion to alphabet letters
- [X] `base32`: classical conversion according to the RFC4648 with all its variants ([zbase32](https://philzimmermann.com/docs/human-oriented-base-32-encoding.txt), extended hexadecimal, [geohash](https://en.wikipedia.org/wiki/Geohash), [Crockford](https://www.crockford.com/base32.html))
- [X] `base36`: [Base36](https://en.wikipedia.org/wiki/Base36) conversion to letters and digits (with a variant inverting both groups)
- [X] `base45`: [Base45](https://datatracker.ietf.org/doc/html/draft-faltstrom-base45-04.txt) DRAFT algorithm (with a variant inverting letters and digits)
- [X] `base58`: multiple versions of [Base58](https://en.bitcoinwiki.org/wiki/Base58) (bitcoin, flickr, ripple)
- [X] `base62`: [Base62](https://en.wikipedia.org/wiki/Base62) conversion to lower- and uppercase letters and digits (with a variant with letters and digits inverted)
- [X] `base63`: similar to `base62` with the "`_`" added
- [X] `base64`: classical conversion according to RFC4648 with its variant URL (or *file*) (it also holds a variant with letters and digits inverted)
- [X] `base67`: custom conversion using some more special characters (also with a variant with letters and digits inverted)
- [X] `base85`: all variants of Base85 ([Ascii85](https://fr.wikipedia.org/wiki/Ascii85), [z85](https://rfc.zeromq.org/spec/32), [Adobe](https://dencode.com/string/ascii85), [(x)btoa](https://dencode.com/string/ascii85), [RFC1924](https://datatracker.ietf.org/doc/html/rfc1924), [XML](https://datatracker.ietf.org/doc/html/draft-kwiatkowski-base85-for-xml-00))
- [X] `base91`: [Base91](http://base91.sourceforge.net) custom conversion
- [X] `base100` (or *emoji*): [Base100](https://github.com/AdamNiederer/base100) custom conversion
- [X] `base122`: [Base100](http://blog.kevinalbs.com/base122) custom conversion
- [X] `base-genericN`: see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html) ; supports any possible base

This category also contains `ascii85`, `adobe`, `[x]btoa`, `zeromq` with the `base85` codec.

#### [Binary](https://python-codext.readthedocs.io/en/latest/enc/binary.html)

- [X] `baudot`: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
- [X] `baudot-spaced`: variant of `baudot` ; groups of 5 bits are whitespace-separated
- [X] `baudot-tape`: variant of `baudot` ; outputs a string that looks like a perforated tape
- [X] `bcd`: _Binary Coded Decimal_, encodes characters from their (zero-left-padded) ordinals
- [X] `bcd-extended0`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `0000`
- [X] `bcd-extended1`: variant of `bcd` ; encodes characters from their (zero-left-padded) ordinals using prefix bits `1111`
- [X] `excess3`: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
- [X] `gray`: aka reflected binary code
- [X] `manchester`: XORes each bit of the input with `01`
- [X] `manchester-inverted`: variant of `manchester` ; XORes each bit of the input with `10`
- [X] `rotateN`: rotates characters by the specified number of bits (*N* belongs to [1, 7] ; Python 3 only)

#### [Common](https://python-codext.readthedocs.io/en/latest/enc/common.html)

- [X] `a1z26`: keeps words whitespace-separated and uses a custom character separator
- [X] `cases`: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
- [X] `dummy`: set of simple encodings (including integer, replace, reverse, word-reverse, substite and strip-spaces)
- [X] `octal`: dummy octal conversion (converts to 3-digits groups)
- [X] `octal-spaced`: variant of `octal` ; dummy octal conversion, handling whitespace separators
- [X] `ordinal`: dummy character ordinals conversion (converts to 3-digits groups)
- [X] `ordinal-spaced`: variant of `ordinal` ; dummy character ordinals conversion, handling whitespace separators

#### [Compression](https://python-codext.readthedocs.io/en/latest/enc/compressions.html)

- [X] `gzip`: standard Gzip compression/decompression
- [X] `lz77`: compresses the given data with the algorithm of Lempel and Ziv of 1977
- [X] `lz78`: compresses the given data with the algorithm of Lempel and Ziv of 1978
- [X] `pkzip_deflate`: standard Zip-deflate compression/decompression
- [X] `pkzip_bzip2`: standard BZip2 compression/decompression
- [X] `pkzip_lzma`: standard LZMA compression/decompression

> :warning: Compression functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.

#### [Cryptography](https://python-codext.readthedocs.io/en/latest/enc/crypto.html)

- [X] `affine`: aka Affine Cipher
- [X] `atbash`: aka Atbash Cipher
- [X] `bacon`: aka Baconian Cipher
- [X] `barbie-N`: aka Barbie Typewriter (*N* belongs to [1, 4])
- [X] `citrix`: aka Citrix CTX1 password encoding
- [X] `railfence`: aka Rail Fence Cipher
- [X] `rotN`: aka Caesar cipher (*N* belongs to [1,25])
- [X] `scytaleN`: encrypts using the number of letters on the rod (*N* belongs to [1,[)
- [X] `shiftN`: shift ordinals (*N* belongs to [1,255])
- [X] `xorN`: XOR with a single byte (*N* belongs to [1,255])

> :warning: Crypto functions are of course definitely **NOT** encoding functions ; they are implemented for leveraging the `.encode(...)` API from `codecs`.

#### [Hashing](https://python-codext.readthedocs.io/en/latest/enc/hashing.html)

- [X] `blake`: includes BLAKE2b and BLAKE2s (Python 3 only ; relies on `hashlib`)
- [X] `checksums`: includes Adler32 and CRC32 (relies on `zlib`)
- [X] `crypt`: Unix's crypt hash for passwords (Python 3 and Unix only ; relies on `crypt`)
- [X] `md`: aka Message Digest ; includes MD4 and MD5 (relies on `hashlib`)
- [X] `sha`: aka Secure Hash Algorithms ; includes SHA1, 224, 256, 384, 512 (Python2/3) but also SHA3-224, -256, -384 and -512 (Python 3 only ; relies on `hashlib`)
- [X] `shake`: aka SHAKE hashing (Python 3 only ; relies on `hashlib`)

> :warning: Hash functions are of course definitely **NOT** encoding functions ; they are implemented for convenience with the `.encode(...)` API from `codecs` and useful for chaning codecs.

#### [Languages](https://python-codext.readthedocs.io/en/latest/enc/languages.html)

- [X] `braille`: well-known braille language (Python 3 only)
- [X] `ipsum`: aka lorem ipsum
- [X] `galactic`: aka galactic alphabet or Minecraft enchantment language (Python 3 only)
- [X] `leetspeak`: based on minimalistic elite speaking rules
- [X] `morse`: uses whitespace as a separator
- [X] `navajo`: only handles letters (not full words from the Navajo dictionary)
- [X] `radio`: aka NATO or radio phonetic alphabet
- [X] `southpark`: converts letters to Kenny's language from Southpark (whitespace is also handled)
- [X] `southpark-icase`: case insensitive variant of `southpark`
- [X] `tap`: converts text to tap/knock code, commonly used by prisoners
- [X] `tomtom`: similar to `morse`, using slashes and backslashes

#### [Others](https://python-codext.readthedocs.io/en/latest/enc/others.html)

- [X] `dna`: implements the 8 rules of DNA sequences (N belongs to [1,8])
- [X] `letter-indices`: encodes consonants and/or vowels with their corresponding indices
- [X] `markdown`: unidirectional encoding from Markdown to HTML

#### [Steganography](https://python-codext.readthedocs.io/en/latest/enc/stegano.html)

- [X] `hexagram`: uses Base64 and encodes the result to a charset of [I Ching hexagrams](https://en.wikipedia.org/wiki/Hexagram_%28I_Ching%29) (as implemented [here](https://github.com/qntm/hexagram-encode))
- [X] `klopf`: aka Klopf code ; Polybius square with trivial alphabetical distribution
- [X] `resistor`: aka resistor color codes
- [X] `rick`: aka Rick cipher (in reference to Rick Astley's song "*Never gonna give you up*")
- [X] `sms`: also called _T9 code_ ; uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
- [X] `whitespace`: replaces bits with whitespaces and tabs
- [X] `whitespace_after_before`: variant of `whitespace` ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "`whitespace+2*after-3*before`")

#### [Web](https://python-codext.readthedocs.io/en/latest/enc/web.html)

- [X] `html`: implements entities according to [this reference](https://dev.w3.org/html5/html-author/charref)
- [X] `url`: aka URL encoding

## :clap: Supporters

[![Stargazers repo roster for @dhondta/python-codext](https://reporoster.com/stars/dark/dhondta/python-codext)](https://github.com/dhondta/python-codext/stargazers)

[![Forkers repo roster for @dhondta/python-codext](https://reporoster.com/forks/dark/dhondta/python-codext)](https://github.com/dhondta/python-codext/network/members)

Back to top