An open API service indexing awesome lists of open source software.

https://github.com/edmundkorley/text2dna

A small service to encode input as a DNA sequence 🐛
https://github.com/edmundkorley/text2dna

bioinformatics dna encoding storage

Last synced: 6 months ago
JSON representation

A small service to encode input as a DNA sequence 🐛

Awesome Lists containing this project

README

          

# text2DNA

A small service to encode input as DNA 🐛

Run `make encode`, in the project root, to compile the executable `encode`, then pass in strings as command-line arguments to see their DNA encoded version.

```sh
$ cd text2dna/
$ make encode
$ ./encode "DNA is nature's DropBox."
CACACATGCAACAGAACGGCCTATAGAACGTGCGACCTCACTCCCTAGCGCCAGCTCTATAGAACACACTAGCGTTCTAACAAGCGTTCTGAAGTG
```

## License

Copyright 2016 Edmund Korley

Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at

http://www.apache.org/licenses/LICENSE-2.0

Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.