https://github.com/gregorybchris/typogenetics
From Douglas Hofstadter's "Gödel, Escher, Bach" (1979)
https://github.com/gregorybchris/typogenetics
biology dna douglas genetics hofstadter replication rna science strands typogenetics
Last synced: 10 months ago
JSON representation
From Douglas Hofstadter's "Gödel, Escher, Bach" (1979)
- Host: GitHub
- URL: https://github.com/gregorybchris/typogenetics
- Owner: gregorybchris
- License: mit
- Created: 2023-12-28T08:59:06.000Z (over 2 years ago)
- Default Branch: main
- Last Pushed: 2025-06-14T09:33:13.000Z (12 months ago)
- Last Synced: 2025-06-14T10:20:13.546Z (12 months ago)
- Topics: biology, dna, douglas, genetics, hofstadter, replication, rna, science, strands, typogenetics
- Language: Python
- Homepage:
- Size: 132 KB
- Stars: 6
- Watchers: 1
- Forks: 0
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
- License: LICENSE
Awesome Lists containing this project
README
# Typogenetics
Implementation of the artificial evolutionary system described in Douglas Hofstadter's "Gödel, Escher, Bach".
Typogenetics (or "typographical genetics") is a toy model of biological genetics. It boils real biology down to a small set of concepts and rules to make the core principles of genetics more intuitive.
**In biological terms**: Strands of bases are translated into sequences of amino acids. Amino acid sequences are folded into enzymes that can operate on strands by editing them. Applying enzymes to strands produces new strands. Those new strands can in turn be translated into even more amino acid sequences and enzymes. By evolving a population of enzymes we can search for an enzyme (or network of interacting enzymes) that constitutes a very rudimentary form of artificial life.
**In computer terms**: The Typogenetics interpreter executes a program on some input text. The output produced by the interpreter is some text that may itself be another valid program. If the output is a valid program, we can execute it using the same interpreter. If the output is not a valid program, we can still use that output as input text to a valid program. We can run this interpreter in a loop and search for a program that produces itself when given the right input.
For the nitty gritty of the Typogenetics specification see [spec.md](spec.md)
For some additional thoughts on ways to extend Typogenetics see [extensions.md](extensions.md)
## Installation
Install using [uv](https://docs.astral.sh/uv)
```bash
uv sync
```
## Usage
```bash
# Translate a single strand into an enzyme
typo translate ATAGAGAGATCACATGTACGATAC
# Apply an enzyme to a strand to produce a set of new strands
typo rewrite cop-mvl-mvr-swi-cut-rpy AATACTAAACCGA
# Simulate many generations of evolution with a starting strand
typo simulate ATAGCGAATAGGATAATG --iter 10000 --seed 42
# Search for all strands that code for enzymes with similar function
typo search ATAAACGATAATTGACAGAGCGAATG ATCGATAGGGAACATGTCGT --edits 5 --depth 20 --seed 42
```
## Resources
### Repositories
- [andrejjocic/typogenetics](https://github.com/andrejjocic/typogenetics)
- [kortschak/typo](https://github.com/kortschak/typo)
- [lpalma/typogenetics](https://github.com/lpalma/typogenetics)
- [mkpankov/typogenetics](https://github.com/mkpankov/typogenetics)
- [nzni/typogenetics](https://github.com/nzni/typogenetics)
- [palm86/typogenetics](https://github.com/palm86/typogenetics)
- [Quuxplusone/TNT](https://github.com/Quuxplusone/TNT)
### Blogs
- [Gödel, Escher, Bach (David Fifield)](https://www.bamsoftware.com/hacks/geb)
- [A typogenetics implementation in Elixir (Danie Palm)](https://dev.to/palm86/a-typogenetics-implementation-in-elixir-1jfg)
### Papers
- [Autoreplicators and hypercycles in typogenetics (V. Kvasnicka, J. Pospichal)](https://www.sciencedirect.com/science/article/abs/pii/S016612800100464X)
- [Typogenetics: a logic of artificial propagating entities (Harold C. Morris)](https://open.library.ubc.ca/media/stream/pdf/831/1.0106810/1)
- [Typogenetics (Andrew Snare)](https://www.csse.monash.edu.au/hons/projects/1999/Andrew.Snare/thesis.pdf)
- [Typogenetics: an artificial genetic system (Louis Varetto)](https://pubmed.ncbi.nlm.nih.gov/8474250/)