https://github.com/gregorybchris/typogenetics-rust
From Douglas Hofstadter's "Gödel, Escher, Bach" (1979)
https://github.com/gregorybchris/typogenetics-rust
biology dna douglas genetics hofstadter replication rna science strands typogenetics
Last synced: 9 months ago
JSON representation
From Douglas Hofstadter's "Gödel, Escher, Bach" (1979)
- Host: GitHub
- URL: https://github.com/gregorybchris/typogenetics-rust
- Owner: gregorybchris
- Created: 2024-01-15T23:10:50.000Z (over 2 years ago)
- Default Branch: main
- Last Pushed: 2024-01-16T04:36:29.000Z (over 2 years ago)
- Last Synced: 2025-01-12T15:12:35.577Z (over 1 year ago)
- Topics: biology, dna, douglas, genetics, hofstadter, replication, rna, science, strands, typogenetics
- Language: Rust
- Homepage:
- Size: 37.1 KB
- Stars: 0
- Watchers: 1
- Forks: 0
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
Awesome Lists containing this project
README
# Typogenetics Rust
For more information about this project, please see the README for [gregorybchris/typogenetics](https://github.com/gregorybchris/typogenetics).
## Requirements
- [Rust](https://www.rust-lang.org/tools/install)
## Building
```bash
cargo build --release
```
## Usage
```bash
# Change to directory with build output
cd target/release
# Translate a single strand into enzymes
./typogenetics translate ATAGAGAGATCACATGTACGATAC
# Apply an enzyme to a strand to produce a set of new strands
./typogenetics rewrite cop-mvl-mvr-swi-cut-rpy AATACTAAACCGA
# Simulate many generations of evolution with a starting strand
./typogenetics simulate ATAGCGAATAGGATAATG --iter 10000 --seed 42
```