Ecosyste.ms: Awesome
An open API service indexing awesome lists of open source software.
https://github.com/heuermh/ensembl-rest-client
Java client for the Ensembl REST API.
https://github.com/heuermh/ensembl-rest-client
Last synced: 9 days ago
JSON representation
Java client for the Ensembl REST API.
- Host: GitHub
- URL: https://github.com/heuermh/ensembl-rest-client
- Owner: heuermh
- License: lgpl-3.0
- Created: 2013-07-09T17:08:07.000Z (over 11 years ago)
- Default Branch: master
- Last Pushed: 2017-03-14T15:43:21.000Z (over 7 years ago)
- Last Synced: 2024-05-02T00:30:05.275Z (6 months ago)
- Language: Java
- Size: 310 KB
- Stars: 3
- Watchers: 3
- Forks: 1
- Open Issues: 0
-
Metadata Files:
- Readme: README.md
- License: COPYING
Awesome Lists containing this project
README
ensembl-rest-client
===================
Java client for the Ensembl REST API.
[](https://travis-ci.org/heuermh/ensembl-rest-client)
### Hacking ensembl-rest-client
Install
* JDK 1.7 or later, http://openjdk.java.net/
* Apache Maven 3.3.1 or later, http://maven.apache.org/
To build
$ mvn install
To assemble example
$ cd example
$ mvn assembly:assembly
To run example
$ java -jar target/ensembl-rest-client-example-2.1-SNAPSHOT-jar-with-dependencies.jar
archived sequence, ENSG00000157764
ENSG00000157764 Gene GRCh38 77 10 ENSG00000157764.10
lookup, ENSG00000157764
ENSG00000157764 homo_sapiens Gene core 7 140719327 140924764 -1
overlapping variations, 7:140424943-140425043
rs7793448 T [A] 7 140425023 140425023 1
rs10244642 T [C] 7 140425026 140425026 1
variation, rs376247534
rs376247534 T [C] 7 140425406 140425406 1
consequences id search, COSM476
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000479537 T missense_variant
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000479537 T NMD_transcript_variant
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000288602 T missense_variant
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000496384 T missense_variant
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000497784 T 3_prime_UTR_variant
COSM476 7 140753336 140753336 1 ENSG00000157764 ENST00000497784 T NMD_transcript_variant
consequences region search, 9:22125503-22125502:1 T>C
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000584020 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000584816 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000585267 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000581051 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000577551 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000584637 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000582072 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000428597 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000422420 C downstream_gene_variant
temp 9 22125502 22125502 1 ENSG00000240498 ENST00000580576 C downstream_gene_variant
sequence, 9:22125502-22125502:1 plus 25 bp flanking sequence
>chromosome:GRCh38:9:22125477:22125527:1
CTCATACTAACCATATGATCAACAGTTGAAAAGCAGCCACTCGCAGAGGTA
### Using ensembl-rest-client
Add the following dependency declaration to your pom.xml
```xml
com.github.heuermh.ensemblrestclient
ensembl-rest-client
2.1-SNAPSHOT
```
E.g.
```java
// create an injector
Injector injector = Guice.createInjector(new EnsemblRestClientModule());
// lookup service
LookupService lookupService = injector.getInstance(LookupService.class);
Lookup ensg00000157764 = lookupService.lookup("human", "ENSG00000157764");
// overlap service
OverlapService overlapService = injector.getInstance(OverlapService.class);
Variation variation : overlapService.variations("human", "7:140425000-140426000") { ... }
// variation service
VariationService variationService = injector.getInstance(VariationService.class);
VariationConsequences cosm476 = variationService.consequences("human", "COSM476");
VariationConsequences chr9 = variationService.consequences("human", "9:22125502-22125502:1", "C");
// sequence service
SequenceService sequenceService = injector.getInstance(SequenceService.class);
Sequence sequence = sequenceService.sequence("human", "9:22125502-22125502:1", 25, 25, "soft");
```
or for clients unable to use Guice injection
```java
// create a factory
EnsemblRestClientFactory factory = new EnsemblRestClientFactory("http://rest.ensembl.org/");
// lookup service
LookupService lookupService = factory.createLookupService();
Lookup ensg00000157764 = lookupService.lookup("human", "ENSG00000157764");
// overlap service
OverlapService overlapService = factory.createOverlapService();
Variation variation : overlapService.variations("human", "7:140425000-140426000") { ... }
// variation service
VariationService variationService = factory.createVariationService();
VariationConsequences cosm476 = variationService.consequences("human", "COSM476");
VariationConsequences chr9 = variationService.consequences("human", "9:22125502-22125502:1", "C");
// sequence service
SequenceService sequenceService = factory.createSequenceService();
Sequence sequence = sequenceService.sequence("human", "9:22125502-22125502:1", 25, 25, "soft");
```