https://github.com/mxfold/mxfold2
MXfold2: RNA secondary structure prediction using deep learning with thermodynamic integration
https://github.com/mxfold/mxfold2
deep-learning rna-secondary-structure-prediction
Last synced: 5 months ago
JSON representation
MXfold2: RNA secondary structure prediction using deep learning with thermodynamic integration
- Host: GitHub
- URL: https://github.com/mxfold/mxfold2
- Owner: mxfold
- License: mit
- Created: 2020-08-11T02:44:43.000Z (almost 6 years ago)
- Default Branch: master
- Last Pushed: 2026-01-29T08:50:08.000Z (6 months ago)
- Last Synced: 2026-01-29T23:23:47.364Z (6 months ago)
- Topics: deep-learning, rna-secondary-structure-prediction
- Language: Python
- Homepage:
- Size: 14 MB
- Stars: 157
- Watchers: 5
- Forks: 36
- Open Issues: 16
-
Metadata Files:
- Readme: README.md
- License: LICENSE
Awesome Lists containing this project
README
# MXfold2
RNA secondary structure prediction using deep learning with thermodynamic integration
## Installation
### System requirements
* python (>=3.7)
* pytorch (>=1.4)
* C++17 compatible compiler (tested on Apple clang version 12.0.0 and GCC version 7.4.0) (optional)
### Install from wheel
We provide the wheel python packages for several platforms at [the release](https://github.com/mxfold/mxfold2/releases). You can download an appropriate package and install it as follows:
% pip3 install mxfold2-0.1.2-cp310-cp310-manylinux_2_17_x86_64.whl
### Install from sdist
You can build and install from the source distribution downloaded from [the release](https://github.com/mxfold/mxfold2/releases) as follows:
% pip3 install mxfold2-0.1.2.tar.gz
To build MXfold2 from the source distribution, you need a C++17 compatible compiler.
## Prediction
You can predict RNA secondary structures of given FASTA-formatted RNA sequences like:
% mxfold2 predict test.fa
>DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
(((((((........(((((..((((.....))))...)))))...................(((((.......)))))))))))). (24.8)
By default, MXfold2 employs the parameters trained from TrainSetA and TrainSetB (see our paper).
We provide other pre-trained models used in our paper. You can download [``models-0.1.0.tar.gz``](https://github.com/mxfold/mxfold2/releases/download/v0.1.0/models-0.1.0.tar.gz) and extract the pre-trained models from it as follows:
% tar -zxvf models-0.1.0.tar.gz
Then, you can predict RNA secondary structures of given FASTA-formatted RNA sequences like:
% mxfold2 predict @./models/TrainSetA.conf test.fa
>DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
(((((((.((....))...........(((((.......))))).(((((......))))).(((((.......)))))))))))). (24.3)
Here, ``./models/TrainSetA.conf`` specifies a lot of parameters including hyper-parameters of DNN models.
## Training
MXfold2 can train its parameters from BPSEQ-formatted RNA sequences. You can also download the datasets used in our paper at [the release](https://github.com/mxfold/mxfold2/releases/tag/v0.1.0).
% mxfold2 train --model MixC --param model.pth --save-config model.conf data/TrainSetA.lst
You can specify a lot of model's hyper-parameters. See ``mxfold2 train --help``. In this example, the model's hyper-parameters and the trained parameters are saved in ``model.conf`` and ``model.pth``, respectively.
## Web server
A web server is working at http://www.dna.bio.keio.ac.jp/mxfold2/.
## References
* Sato, K., Akiyama, M., Sakakibara, Y.: RNA secondary structure prediction using deep learning with thermodynamic integration. *Nat Commun* **12**, 941 (2021). https://doi.org/10.1038/s41467-021-21194-4