An open API service indexing awesome lists of open source software.

https://github.com/onesparse/graphony


https://github.com/onesparse/graphony

Last synced: over 1 year ago
JSON representation

Awesome Lists containing this project

README

          

# Graphony

Graphony is a Python library for doing high-performance graph analysis
using the GraphBLAS over sparse and hypersparse data sets.

Graphony uses
[pygraphblas](https://graphegon.github.io/pygraphblas/pygraphblas/index.html)
to store graph data in sparse [GraphBLAS
Matrices](http://graphblas.org) and node and edge properties in
[PostgreSQL](https://postgresql.org).

Graphony's primary role is to easily construnct graph matrices and
manage symbolic names and properties for graphs, nodes, properties and
edges, and can be used to easily construct, save and manage graph data
in a simple project directory format.

Graphs can be:

- [Simple](https://en.wikipedia.org/wiki/Graph_(discrete_mathematics)#Graph):
an edge connects one source to one destination.

- [Hypergraph](https://en.wikipedia.org/wiki/Hypergraph): a graph
with at lest one *hyperedge* connecting multiple source nodes to
multiple destinations.

- [Multigraph](https://en.wikipedia.org/wiki/Multigraph): multiple
edges can exist between a source and destination.

- [Property
Graph](http://graphdatamodeling.com/Graph%20Data%20Modeling/GraphDataModeling/page/PropertyGraphs.html):
Nodes and and Edges can have arbitrary JSON properties.

# Creating Graphs

This documentation is also a runnable Python test called a
[doctest](). In order to run and verify this documentation, we must
first create some helper objects like a function `p()` that will
iterate results into a list and "pretty print" them. We also have to
setup a test PostgreSQL database and initialize it with the base
Graphony tables.

The core object of Graphony is a `Graph()`. A new Graph can be created
with a connection string to an existing initialized database:

```python3
import os
import pprint
import postgresql
from pathlib import Path
from pygraphblas import FP64, INT64, gviz
from graphony import Graph, Node
p = lambda r: pprint.pprint(sorted(list(r)))
pgdata, conn = postgresql.setup()
postgresql.psql(f'-d "{conn}" -f dbinit/01_init_graphony.sql -f dbinit/02_karate_demo.sql')
G = Graph(conn)
```

The `Graph` object `G` is used throughout the following documenation
to demonstrate the features of Graphony. A Graphony `Graph` consists
of four concepts:

- `Graph`: Top level object that contains all graph data in
sub-graphs called *properties*.

- `Property`: A named, typed sub-graph that holds edges. A
property consists of two GraphBLAS [Incidence
Matrices](https://en.wikipedia.org/wiki/Incidence_matrix) that can
be multiplied to project an adjacency with themselves, or any
other combination of properties.

- `Edge`: Property edges can be simple point to point edges or
hyperedges that represent properties between multiple incoming and
outgoing nodes.

- `Node`: A node in the graph.

# Simple Graphs

Graphs consist of multiple typed subgraphs called *properties*. All
properties share node ids across a Graph object, but each property can
store edge weights of different data types like int, float, or bool.
Internally, "simple" graphs (non-hyper) are stored as [Adjacency
Matrices](https://en.wikipedia.org/wiki/Adjacency_matrix).

Before you can add an edge, a property to hold it must be declared
first. The default edge type is `bool` if you don't specify one:

```python3
>>> G.add_property('friend')
```

Edges can be added directly into the Graph with the `+=` method. In
their simplest form, an edge is a Python tuple with 2 elements a
source and a destination:

```python3
>>> G.friend += ('bob', 'alice')

>>> G.friend.draw(weights=False, filename='docs/imgs/G_friend_1')

```
![G_friend_1.png](docs/imgs/G_friend_1.png)

Using strings like `'bob'` and `'alice'` as edge endpoints creates new
graph nodes automatically. You can also create nodes explicity and
provide attributes for them:

```python3
>>> jane = Node(G, 'jane', favorite_color='blue')
>>> jane.favorite_color
'blue'
>>> G.friend += ('alice', jane)

>>> G.friend.draw(weights=False, filename='docs/imgs/G_friend_2')

```
![G_friend_2.png](docs/imgs/G_friend_2.png)

Now there are two edges in the `friend` property, one from bob to
alice and the other from alice to jane.

```python3
>>> p(G.friend)
[friend(bob, alice), friend(alice, jane)]
```

An iterator of property tuples can also be provided to the `+=`
operator which will consume them and add them to the property:

```python3
>>> G.friend += [('bob', 'sal'), ('alice', 'rick')]

>>> G.friend.draw(weights=False, filename='docs/imgs/G_friend_3')

```
![G_friend_3.png](docs/imgs/G_friend_3.png)

As shown above, tuples are stored as boolean edges whose weights are
always `True` and therefore can be ommited.

# Hypergraphs

A [Hypergraph](https://en.wikipedia.org/wiki/Hypergraph) is a
generalization of a graph in which an edge can join any number of
vertices in constrast to a simple graph, shown above, where an edge
has exactly two endpoints and can only connect only one vertex to one
other vertex.

In Graphony a hypergraph can created in any *incidence* property by
passing the `incidence=True` flag. This causes the property to be
stored internally as two [Incidence
Matrices](https://en.wikipedia.org/wiki/Incidence_matrix) which can
represent non-simple graphs like the hypergraph shown here:

```python3
>>> G.add_property('manages', incidence=True)
```

New hyperedges can be defined by passing a nested tuple of nodes as
either the source or destinations, or both, for a hyperedge.

```python3
>>> G.manages += [('bob', ('rick', 'alice')), (('alice', 'bob'), 'jane')]

>>> G.manages.draw(weights=True, filename='docs/imgs/G_manages_1')

```
![G_manages_1.png](docs/imgs/G_manages_1.png)

Here a hyperedge with one source and two destinations is created from
bob to jane and alice, and another with two sources and one
destination is created from alice and bob to jane.

# Property Graph

Graphs can have any number of properties, each with a particular
GraphBLAS type. In general this is referred to as a Property Graph.
As shown above the default property type is `bool` which created
unweighted edges, but graph edge types can be specified on a
per-property basis:

```python3
>>> G.add_property('distance', int)
>>> G.distance += [('bob', 'alice', 422), ('alice', 'jane', 42)]

>>> G.distance.draw(weights=True, filename='docs/imgs/G_distance_2')

```
![G_distance_2.png](docs/imgs/G_distance_2.png)

Supported python types include `bool`, `int`, `float` and `complex`
which are converted into the GraphBLAS types `GrB_BOOL`, `GrB_INT64`,
`GrB_FP64` and `GxB_FC64` for storage. You can also pass a specific
GraphBLAS type if you want different precision or a custom type.

# Graph Querying

Currently our graph looks like this, it contains 3 properties,
`friend`, `manages` and `distance`:

```python3
>>> G.draw(weights=True, filename='docs/imgs/G_all_1')

```

![G_all_1.png](docs/imgs/G_all_1.png)

Graphs have a call interface like `G(...)` that can be used to query
individual edges. A query consists of three optional arguments for
`source`, `property` and `destination`. The default value for all
three is None, which acts as a wildcard to matches all values.

```python3
>>> p(G())
[friend(bob, alice),
friend(bob, sal),
friend(alice, jane),
friend(alice, rick),
manages((bob), (alice, rick), (True, True)),
manages((bob, alice), (jane), (True)),
distance(bob, alice, 422),
distance(alice, jane, 42)]
```

Only print edges where `bob` is the src:

```python3
>>> p(G(source='bob'))
[friend(bob, alice),
friend(bob, sal),
manages((bob), (alice, rick), (True, True)),
manages((bob, alice), (jane), (True)),
distance(bob, alice, 422)]
```

Only print edges where `manages` is the property:

```python3
>>> p(G(property='manages'))
[manages((bob), (alice, rick), (True, True)),
manages((bob, alice), (jane), (True))]

```

Only print edges where `jane` is the destination:

```python3
>>> p(G(destination='jane'))
[friend(alice, jane),
manages((bob, alice), (jane), (True)),
distance(alice, jane, 42)]
```

Only print edges that match that `bob` is a `manages` of `jane`.
Note in this case it returns two hyperedges, as in both cases bob is a
source and jane is a destination:

```python3
>>> p(G(source='bob', property='manages', destination='jane'))
[manages((bob, alice), (jane), (True))]
```

# Loading Graphs from SQL

Any tuple producing iterator can be used to construct Graphs.
Graphony offers a shorthand helper for this. Any query that produces
2 or 3 columns can be used to produce edges into the graph.

```python3
>>> G.add_property('karate')
>>> G.karate += G.sql("select 'k_' || s_id, 'k_' || d_id from graphony.karate")

>>> G.karate.draw(weights=False, filename='docs/imgs/G_karate_3',
... directed=False, graph_attr=dict(layout='sfdp'))

```
![G_karate_3.png](docs/imgs/G_karate_3.png)

All the edges are in the karate property, as defined in the sql
query above:

```python3
>>> len(G.karate)
78
```

# Multigraphs

In a [Multigraph](https://en.wikipedia.org/wiki/Multigraph) multiple
edges can exist between two nodes. A good example is a [De
Bruijn](https://en.wikipedia.org/wiki/De_Bruijn_graph) graph, a
directed graph that represents overlapping sequences of symbols.

These graphs are used in bioinformatics to analyze and assemble long
sequences of genetic data. Construction involves iterating a sequence
of genetic information and constructing multiple edges between pairs
of nodes.

```python3
>>> from more_itertools import windowed
>>> G.add_property('debruijn', incidence=True)
>>> def kmer(t, k=3):
... return (tuple(map("".join, windowed(i, k-1))) for i in map("".join, windowed(t, k)))

>>> G.debruijn += kmer('ATCGATCGGATGACAGACACAATTC')
>>> G.debruijn.draw(graph_attr=dict(layout='circo'), weights=False, concentrate=True, filename='docs/imgs/G_debruijn_1')

```
![G_debruijn_1.png](docs/imgs/G_debruijn_1.png)

Once the graph is built up it can be "collapsed" into a weighted
graph, where the multi-edges between nodes are summed up into a single
edge. In the GraphBLAS this can be accomplished by calling the
properties with a semiring:

```python3
>>> M = G.debruijn(INT64.plus_pair)
>>> gviz.draw_graph(M, weights=True, label_vector=G.debruijn.label_vector(M),
... graph_attr=dict(layout='circo'), filename='docs/imgs/G_debruijn_2')

```
![G_debruijn_2.png](docs/imgs/G_debruijn_2.png)

# Example Weighted De Bruijn using BioPython

Here's an example or using [Biopython](https://biopython.org/) to
create an weighted De Bruijn graph of a Circovirus:

```python3
>>> from Bio import SeqIO, Entrez
>>> Entrez.email = "info@graphegon.com"
>>> handle = Entrez.efetch(db="nucleotide", id="MZ299081", rettype="gb", retmode="text")
>>> record = SeqIO.read(handle, "genbank")
>>> handle.close()
>>> from more_itertools import windowed
>>> G.add_property('circovirus', incidence=True)
>>> def kmer(t, k=3):
... return (tuple(map("".join, windowed(i, k-1))) for i in map("".join, windowed(t, k)))
>>> seq = str(record.seq)
>>> G.circovirus += kmer(seq, 3)
>>> M = G.circovirus(INT64.plus_pair)
>>> gviz.draw_graph(M, weights=True, labels=True, label_vector=G.circovirus.label_vector(M),
... graph_attr=dict(layout='sfdp'), filename='docs/imgs/G_circovirus_1')

```
![G_circovirus_1.png](docs/imgs/G_circovirus_1.png)

```python3
postgresql.teardown(pgdata)
```