https://github.com/opengene/fusiondirect.jl
(No maintenance) Detect gene fusion directly from raw fastq files
https://github.com/opengene/fusiondirect.jl
bioinformatics cancer fusion gene ngs
Last synced: 8 months ago
JSON representation
(No maintenance) Detect gene fusion directly from raw fastq files
- Host: GitHub
- URL: https://github.com/opengene/fusiondirect.jl
- Owner: OpenGene
- License: other
- Created: 2015-12-27T03:01:12.000Z (almost 10 years ago)
- Default Branch: master
- Last Pushed: 2017-08-13T00:09:21.000Z (about 8 years ago)
- Last Synced: 2023-10-20T22:12:11.969Z (almost 2 years ago)
- Topics: bioinformatics, cancer, fusion, gene, ngs
- Language: Julia
- Homepage:
- Size: 87.9 KB
- Stars: 25
- Watchers: 8
- Forks: 16
- Open Issues: 6
-
Metadata Files:
- Readme: README.md
- License: LICENSE.md
Awesome Lists containing this project
README
# FusionDirect
detect gene fusion directly from fastq files, written in [Julia](http://julialang.org/) language
## Features
* no alignment needed, it just reads fastq files of pair sequencing
* output fusion pattern (gene and position), along with the reads support this fusion
* ultra sensitive, comparing to delly, factera or other tools
* output file is a standard fasta file, which can be used to verify fusions using blast or other tools
* very suitable for detecting fusions from cancer target sequencing data (exom seq or panel seq)## Julia
Julia is a fresh programming language with `C/C++` like performance and `Python` like simple usage
On Ubuntu, you can install Julia by `sudo apt-get install julia`, and type `julia` to open Julia interactive prompt## Install FusionDirect
```julia
# from Julia REPL
Pkg.add("FusionDirect")
```## Use FusionDirect as a package
```julia
using FusionDirect# the reference folder, which contains chr1.fa, chr2fa...
# download from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz and gunzip it
ref = "/opt/ref/hg19chr"
# a gene list with their coordination intervals, see the example bed files in data folder
bed = Pkg.dir("FusionDirect") * "/data/test_panel.bed"
read1 = "R1.fq.gz"
read2 = "R2.fq.gz"
detect(ref, bed, read1, read2)
```## Use FusionDirect as a standalone script from commandline
copy src/fusion.jl to anywhere you want, run
```shell
julia fusion.jl -f -b -l -r > output.fa
# here gives an example
# (hg19chr is downloaded and gunzipped from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz )
julia fusion.jl -f ~/hg19chr -b ~/.julia/v0.5/FusionDirect/data/lung_cancer_hg19.bed -l R1.fq -r R2.fq > ourput.fa```
## Get the reference
Can be downloaded from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz
You should run `gunzip chromFa.tar.gz` then pass the folder contains fa files to `-f `## Prepare the bed
A bed file to give a gene list (chr, start, end, genename), it usually includes the gene panel of your target sequencing and other genes you have interest (like EML4). You can use `data/lung_cancer_hg19.bed` if you don't know how to make it.
Here gives an example:
```
chr9 133588266 133763062 ABL1
chr14 105235686 105262088 AKT1
chr19 40736224 40791443 AKT2
chr2 29415640 30144432 ALK
chrX 66764465 66950461 AR
chr11 108093211 108239829 ATM
chr3 142168077 142297668 ATR
chr2 111876955 111926024 BCL2L11
chr7 140419127 140624564 BRAF
chr17 41196312 41277500 BRCA1
chr2 42396490 42559688 EML4
```## Understand the output
* fasta: The output is a standard fasta, which can be directly used to double check these fusions with blast(http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome)
* duplication number: the first nubmer after `>` is the number of duplicated reads (including this displaying read), so it is at least 1.
* fusion_site: The followed word can be `merged`, `read1`, `read2` or `crosspair`, which means the fusion is detected on merged sequence, read1, read2 or read1/read2 are not on same contig.
* conjunct_pos: the number after `fusion_site`, which means in which base the fusion happens. If `fusion_site` is `merged`, then the number is according to the merged sequence. If `fusion_site` is `crosspair`, then this value is set 0.
* fusion_genes: following `conjunct_pos`, the two fusion genes, intron/exon number and the global fusion coordinations are given. `+` or `-` means forward strand or reverse strand. Note that fusion is on double strand DNA, so both `+` and `-` can exist on same fusion.
* original_reads: original reads are given for read1/read2. See `/1` or `/2` in the tail of read name.
* merged_sequence: if the pair of reads can be merged automatically, the fusion detection is done on the merged sequence. In this case, merged sequence is given with `/merge` in the tail of its read name.
```
#Fusion:ALK-EML4 (total: 3, unique: 2)
>2_merged_120_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/1
AATTGAACCTGTGTATTTATCCTCCTTAAGCTAGATTTCCATCATACTTAGAAATACTAATAAAATGATTAAAGAAGGTGTGTCTTTAATTGAAGCATGATTTAAAGTAAATGCAAAGCTATGTCGTCCAATCAATGTCCTTACAATC
>2_merged_120_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/2
GCTGCAAACTAATCAGGAATCGATCGGATTGTAAGGACATTGATTGGACGACATAGCTTTGCATTTACTTAAAATCATGCTTCAATTAAAGACACACCTTCTTTAATCATTTTATTAGTATTTCTAAGTATGATGGAAATCTATCTTAA
>2_merged_120_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/merged
AATTGAACCTGTGTATTTATCCTCCTTAAGCTAGATTTCCATCATACTTAGAAATACTAATAAAATGATTAAAGAAGGTGTGTCTTTAATTGAAGCATGATTTAAAGTAAATGCAAAGCTATGTCGTCCAATCAATGTCCTTACAATCCGATCGATTCCTGATTAGTTTGCAGC
>1_merged_60_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/1
TAAAATGATTAAAGAAGGTGTGTCTTTAATTGAAGCATGATTTAAAGTAAATGCAAAGCTATGTCGTCCAATCAATGTCCTTACAATCCGATCGATTCCTGATTAGTTTGCAGCCATTTGGAATGTCCCCTTTAAATTTAGAAACAG
>1_merged_60_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/2
GTAAAAGTGGCTAGTTTGAATCAAGATGCACTTTCAAATACATTTGTACACAAGCACTATGATTATACTTCCTGTTTCTAAATTTAAAGGGGACATTCCAAATGGCTGCAAACTAATCAGGAATCGATCGGATTGTAAGGACATTGATT
>1_merged_60_ALK:intron:19|+chr2:29446598_EML4:exon:21|-chr2:42553364/merged
TAAAATGATTAAAGAAGGTGTGTCTTTAATTGAAGCATGATTTAAAGTAAATGCAAAGCTATGTCGTCCAATCAATGTCCTTACAATCCGATCGATTCCTGATTAGTTTGCAGCCATTTGGAATGTCCCCTTTAAATTTAGAAACAGGAAGTATAATCATAGTGCTTGTGTACAAATGTATTTGAAAGTGCATCTTGATTCAAACTAGCCACTTTTAC
```