https://github.com/openscilab/opr
OPR: Optimized Primer
https://github.com/openscilab/opr
Last synced: 9 months ago
JSON representation
OPR: Optimized Primer
- Host: GitHub
- URL: https://github.com/openscilab/opr
- Owner: openscilab
- License: mit
- Created: 2024-01-27T08:11:26.000Z (over 2 years ago)
- Default Branch: main
- Last Pushed: 2025-01-09T13:37:32.000Z (over 1 year ago)
- Last Synced: 2025-01-09T14:32:48.766Z (over 1 year ago)
- Language: Python
- Homepage:
- Size: 89.8 KB
- Stars: 7
- Watchers: 2
- Forks: 0
- Open Issues: 6
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- Contributing: .github/CONTRIBUTING.md
- License: LICENSE
- Code of conduct: .github/CODE_OF_CONDUCT.md
- Security: SECURITY.md
- Authors: AUTHORS.md
Awesome Lists containing this project
README
OPR: Optimized Primer
----------
## Overview
OPR is an open-source Python package designed to simplify and streamline primer design and analysis for biologists and bioinformaticians. OPR enables users to design, validate, and optimize primers with ease, catering to a wide range of applications such as PCR, qPCR, and sequencing. With a focus on user-friendliness and efficiency, OPR aims to bridge the gap between biological research and computational tools, making primer-related workflows faster and more reliable.
PyPI Counter
Github Stars
Branch
main
dev
CI
Code Quality
## Installation
### PyPI
- Check [Python Packaging User Guide](https://packaging.python.org/installing/)
- Run `pip install opr==0.5`
### Source code
- Download [Version 0.5](https://github.com/openscilab/opr/archive/v0.5.zip) or [Latest Source](https://github.com/openscilab/opr/archive/dev.zip)
- Run `pip install .`
## Usage
### Load
```pycon
>>> from opr import Primer, MeltingTemperature
>>> primer1 = Primer(sequence="CTGGAGGACGGAAGAGGAAGTAA", salt=50)
>>> primer1.sequence
'CTGGAGGACGGAAGAGGAAGTAA'
```
### Properties
#### Molecular weight
```pycon
>>> primer1.molecular_weight
7235.79
```
#### GC content
```pycon
>>> primer1.gc_content
0.5217391304347826
```
#### GC clamp
```pycon
>>> primer1.gc_clamp
1
```
#### Single run length
```pycon
>>> primer1.single_runs
{'A': 2, 'T': 1, 'C': 1, 'G': 2}
```
#### Double run length
```pycon
>>> primer1.double_runs
{'TA': 1, 'TC': 0, 'TG': 1, 'AT': 0, 'AC': 1, 'AG': 2, 'CT': 1, 'CA': 0, 'CG': 1, 'GT': 1, 'GA': 1, 'GC': 0}
```
#### Repeats
```pycon
>>> primer1.repeats(sequence="GG", consecutive=False)
4
```
```pycon
>>> primer1.repeats(sequence="GG", consecutive=True)
1
```
#### Melting temperature
##### Basic
```pycon
>>> primer1.melting_temperature()
57.056521739130446
>>> primer1.melting_temperature(MeltingTemperature.BASIC)
57.056521739130446
```
##### Salt-adjusted
```pycon
>>> primer1.melting_temperature(MeltingTemperature.SALT_ADJUSTED)
64.64203250676053
```
##### Nearest neighbor
```pycon
>>> primer1.melting_temperature(MeltingTemperature.NEAREST_NEIGHBOR)
66.42693710590595
```
#### Thermodynamic Constants
##### Enthalpy change (ΔH)
```pycon
>>> primer1.delta_h
-174.99999999999997
```
##### Entropy change (ΔS)
```pycon
>>> primer1.delta_s
-0.44210000000000005
```
#### Extinction Coefficient at 260 nm (E260)
```pycon
>>> primer1.E260
248.40000000000006
```
### Operations
#### Reverse
```pycon
>>> primer1_reversed = primer1.reverse()
>>> primer1_reversed.sequence
'AATGAAGGAGAAGGCAGGAGGTC'
```
#### Complement
```pycon
>>> primer1_complemented = primer1.complement()
>>> primer1_complemented.sequence
'GACCTCCTGCCTTCTCCTTCATT'
```
#### To RNA
```pycon
>>> oprimer_rna = oprimer.to_rna()
>>> oprimer_rna
'CUGGAGGACGGAAGAGGAAGUAA'
```
#### To protein
```pycon
>>> oprimer_protein = oprimer.to_protein(frame=3)
>>> oprimer_protein
'GGRKRK*'
>>> oprimer_protein_aa3 = oprimer.to_protein(frame=3, multi_letter=True)
>>> oprimer_protein_aa3
'Gly-Gly-Arg-Lys-Arg-Lys-Stop'
```
ℹ️ When the `frame=3` it starts from the third nucleotide. The list of codons is then [`GGA`(G), `GGA`(G), `CGG`(R), `AAG`(K), `AGG`(R), `AAG`(K), `TAA`(STOP)]
ℹ️ Stop signal is marked as `*` in OPR
## Issues & bug reports
Just fill an issue and describe it. We'll check it ASAP! or send an email to [opr@openscilab.com](mailto:opr@openscilab.com "opr@openscilab.com").
- Please complete the issue template
You can also join our discord server
## References
1- Oligo Calc: Oligonucleotide Properties Calculator
2- Marmur, Julius, and Paul Doty. "Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature." Journal of molecular biology 5.1 (1962): 109-118.
3- Wallace, R. Bruce, et al. "Hybridization of synthetic oligodeoxyribonucleotides to Φ X 174 DNA: the effect of single base pair mismatch." Nucleic acids research 6.11 (1979): 3543-3558.
4- Panjkovich, Alejandro, and Francisco Melo. "Comparison of different melting temperature calculation methods for short DNA sequences." Bioinformatics 21.6 (2005): 711-722.
## Show your support
### Star this repo
Give a ⭐️ if this project helped you!
### Donate to our project
If you do like our project and we hope that you do, can you please support us? Our project is not and is never going to be working for profit. We need the money just so we can continue doing what we do ;-) .
