https://github.com/pfizer-opensource/nf-crispr-primer-design
Nextflow pipeline for primer design for sequencing CRISPR target sites
https://github.com/pfizer-opensource/nf-crispr-primer-design
Last synced: about 1 month ago
JSON representation
Nextflow pipeline for primer design for sequencing CRISPR target sites
- Host: GitHub
- URL: https://github.com/pfizer-opensource/nf-crispr-primer-design
- Owner: pfizer-opensource
- License: apache-2.0
- Created: 2025-04-29T00:20:27.000Z (about 1 year ago)
- Default Branch: main
- Last Pushed: 2025-05-02T14:32:23.000Z (about 1 year ago)
- Last Synced: 2025-09-05T13:56:50.328Z (10 months ago)
- Language: Python
- Size: 94.7 KB
- Stars: 1
- Watchers: 1
- Forks: 1
- Open Issues: 1
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- License: LICENSE
- Citation: CITATIONS.md
Awesome Lists containing this project
README
# pfizer-opensource/nf-crispr-primer-design
## Introduction
**pfizer-opensource/nf-crispr-primer-design** is a bioinformatics pipeline that designs primers
for sequencing CRISPR-edited target sites. The pipeline takes CRISPR guide sequences as
input, finds their location in a reference genome, and then designs primers to amplify
the edited region. In addition to outputing target-specific primers, the pipeline can
also generate primers with NGS adapter sequences added on. This pipeline is a companion
to the **pfizer-opensource/nf-gene-editing-ngs** pipeline, and produces an `amplicons.yaml` file
that is compatible with that gene editing NGS analysis pipeline.
## Usage
> [!NOTE]
> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow.
The only required input file is a tab-delimited text file with guide identifiers and
guide sequences. The input data should look like this:
`guides.txt`:
```tsv
guide_id guide_seq
HPRT-ctrl AATTATGGGGATTACTAGGA
```
Each row represents a CRISPR guide, and a primer pair will be designed for that guide.
You will also need to tell the pipeline which reference genome to use for the primer
design and a prefix string to use for naming the output files.
Now, you can run the pipeline using:
```bash
nextflow run pfizer-opensource/nf-crispr-primer-design \
-profile \
--input guides.txt \
--genome GRCh38 \
--prefix my_guides \
--outdir
```
> [!WARNING]
> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).
## Credits
pfizer-opensource/nf-crispr-primer-design was originally written by Jason Arroyo.
## Contributions and Support
If you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).
## Citations
An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.
This pipeline uses code and infrastructure developed and maintained by the [nf-core](https://nf-co.re) community, reused here under the [MIT license](https://github.com/nf-core/tools/blob/main/LICENSE).
> **The nf-core framework for community-curated bioinformatics pipelines.**
>
> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.
>
> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).