Ecosyste.ms: Awesome

An open API service indexing awesome lists of open source software.

Awesome Lists | Featured Topics | Projects

https://github.com/rennelab/hkref

Hybkit-Ref: Up-to-date Genomic Sequence Reference Database for Hyb
https://github.com/rennelab/hkref

bioinformatics clash dna genetics genomics hyb mirna qclash ribonomics rna unafold vienna viennad

Last synced: about 2 months ago
JSON representation

Hybkit-Ref: Up-to-date Genomic Sequence Reference Database for Hyb

Awesome Lists containing this project

README 

        
hkref (Hybkit-Reference)

==================================

.. image:: https://img.shields.io/github/v/release/RenneLab/hkref?include_prereleases&logo=github

   :target: https://github.com/RenneLab/hkref/releases

   :alt: GitHub release (latest by date including pre-releases)

.. image:: https://img.shields.io/badge/Made%20with-Python-1f425f.svg?logo=python&logoColor=white

   :target: https://www.python.org/

   :alt: Made with Python

.. image:: https://img.shields.io/badge/Made%20with-Bash-1f425f.svg?logo=gnu-bash

   :target: https://www.gnu.org/software/bash/

   :alt: Made with Bash

.. image:: https://img.shields.io/badge/Bio-python-yellow?logo=data%3Aimage%2Fpng%3Bbase64%2CiVBORw0KGgoAAAANSUhEUgAAABAAAAAQCAMAAAAoLQ9TAAABvFBMVEUAAAD%2F0UEoaaY3cJ%2F%2F0kD2zUWxq2Zvi4VVgJDvyUlIeJfhwk%2FItlyFlnpBdZs%2Bc5w1b6A4cZ%2F%2F%2FwD%2F0UH%2F0UE3cJ83cJ83cJ83cJ%2F%2F0UL%2F0UD%2F0T%2F%2F0UH%2F0kDXvVQ1b6A3cJ83cJ83cJ83cJ%2F%2Fzzr%2F0kT%2F00j%2F0kT%2F0z%2FMuFk7cp02cJ83cJ83cJ83cJ%2F%2F0UH%2F0UH%2F0kX%2F0kb60ELvykiHl3oAT784cZ43cJ83cJ83cJ%2F%2F0UH%2F0UH%2F0UH%2F0T9YgJDQulf%2B0UH51D43cJ83cJ81b6D%2F4TH%2F0UH%2F0UH%2F0UE3cJ8zbqGJmHn%2F0kD%2F0UE3cJ83cJ80bqDSvFX%2F0kD%2F0UE3cJ82b6BghIz%2F00D%2F0UH%2F0UE2cJ80b6CtqWj%2F0z%2F%2F0UE3cJ83cJ83cJ8YYa7%2F0kD%2F0UH%2F0UFxjIRFd5lnh4nfwlA1bp43cJ83cJ83cJ%2F%2F0UH%2F0UH%2F0UH%2F2Tm%2Fsl9Fd5k7cp08dKI7c6E3cJ83cJ%2F%2F0UH%2F0UH%2F0UH%2F0UH5z0NTfpI0b6A6cqE%2FdaM7cqEwa5z%2F0UH%2F0UH%2F0UH%2F0UH%2F0z8vbKM3cJ81b542cJ84caD%2F0UH%2F0UE3cJ83cJ%2F%2F%2F%2F%2BMZpkLAAAAk3RSTlMAAAAAAAAAAAAAAAAAAAAAAAAAAQUKTlYRBiYNBmYkifDyog4EdORih83qcl7scBzb9lBH%2BrIKA5bYH17tdwxW%2Fa0GMOV0DcOtCAu08Og8AprNa%2BtLSOtuzZsDPOjutwwHqsUOcuYyCbr%2BWQtz7WIe1Z4q3PhHTfTdHWXuhrfVsolh5nkECYTo0UQcaQ0pBiYaBQETquGoAAAAl0lEQVQY02NgIAQYGRiFGN8JMzIyvmb4yygBpBkYpRkh4ME%2FZSDJwsDwQgUiwMDCDRb4z8gNETA%2FwwMWZ2axAFLHrCGiO4BanMEssCzjWgYmZgZuEAjcDaYY%2FrMwxEItASlZxMDAlMHDw7MKKMcJUsD0n4EJTE%2Fi4soAM5ghAl8g5nBzBzCABXr%2F%2Fq%2BZxsFR0cFmxEAEAAAfKxn6VT4rZAAAAABJRU5ErkJggg%3D%3D%0A

   :target: https://github.com/biopython/biopython

   :alt: BioPython Project

.. image:: http://biothings.io/static/img/powered-by-mygene.png

   :width: 128 px

   :target: https://mygene.info/

   :alt: Powered by MyGene.info



| This repository is a part of the `hybkit project `_.

| Full hybkit project documentation is available at

  `hybkit's ReadTheDocs `_.



Description:

============

| This repository includes an up-to-date human genomic sequence reference designed to be

  compaitble with the `Hyb `_ program

  for chimeric (hybrid) read calling for ribonomics experiments.

| The method for reference library construction is based on the protocol provided in the

  supplemental methods of:



  | Helwak, Aleksandra, et al. 'Mapping the human miRNA interactome by CLASH reveals

    frequent noncanonical binding.' Cell 153.3 (2013): 654-665.

    http://dx.doi.org/10.1016/j.cell.2013.03.043



| The reference library is primarily based on sequences downloaded from Ensembl via the

  Biomart API, with the use of miRBase for mature miRNA sequences and a few other sequence

  sources.



Biomart queries include:

  * mRNA : transcript_biotype=protein_coding; cdna;

    (limited to where a RefSeq Protein Identifier Exists)

  * lncRNA : transcript_biotype=lncrna; cdna

  * rRNA : transcript_biotype=lncrna; cdna

  * rRNA : transcript_biotype=[Mt_rRNA, rRNA, rRNA_pseudogene]; transcript_exon_intron

  * tRNA : transcript_biotype=Mt_tRNA; transcript_exon_intron

  * other : transcript_biotype=[all remaining]; transcript_exon_intron



For a detailed description of the current sequences and queries utilized, see

"Current Reference Details" below.



Run Reference Creation Pipeline:

================================

The reference pipeline is designed using Nextflow, and has been tested on Nextflow/23.04.1.

Dependency handling is performed with conda modules (containerized implementation

in development).



Required program dependencies are:

  * `nextflow `_ (tested v23.04.1)

  * `seqkit `_ (tested v2.5.1)

  * `bedops `_ (tested v2.4.39)



Required Python Packages:

  * `pandas `_ (tested pandas=1.3.5)

  * `natsort `_ (tested natsort=7.1.1)

  * `pybiomart `_ (tested pybiomart=0.2.0)

  * `biothings-client `_ (tested biothings_client=0.2.6)

  * `biopython `_ (tested biopython=1.79)

  * `pyyaml `_ (tested pyyaml=6.0)



The scripts can be run by executing the first script: "00_run_all.sh" using the presupplied

conda configuration, or by making all required resources (seqkit, python3) available on the system path.



Hyb Reference Specification:

============================

The Hyb program has requirements about the formatting of the FASTA file used for the reference.



Currently identified requirements include:

  * No description in FASTA sequence header (no whitespace characters)

  * | Sequence identifier be of the form of "{1}_{2}_{seqid}_{biotype}"

    | {1}: Arbitrary Identifier (ENSG... for Ensembl Sequences)

    | {2}: Arbitrary Identifier (ENST... for Ensembl Sequences)

    | {3}: Name of gene/miRNA

    | {4}: Ensembl-style transcript_biotype.

    |     (Note, "microRNA" must be used in place of "miRNA" for recognition by Hyb)



  * {1}, {2}, {seqid}, and {biotype} should contain only [a-z], [A-Z], [0-9],

     "-", and "|" characters.

  * "_", ".", and "," characters are *specifically* excluded from identifiers.



Examples:



.. code-block:: bash



    >ENSG00000003137_ENST00000001146_CYP26B1_mRNA

    .....

    >MIMAT0000062_MirBase_let-7a_microRNA

    TGAGGTAGTAGGTTGTATAGTT



Thanks to Grzegorz Kudla ( https://github.com/gkudla ) for providing information on

Hyb reference creation.



Current Reference Details:

==========================



Text of: *./01_notes.sh*



.. code-block:: bash



    Download a reference sequence library for the Hyb program from Ensembl

    using the Biomart python module.



    Library construction is based on the protocol provided in the supplemental methods of:

    Helwak, Aleksandra, et al. 'Mapping the human miRNA interactome by CLASH reveals

    frequent noncanonical binding.' Cell 153.3 (2013): 654-665.

    http://dx.doi.org/10.1016/j.cell.2013.03.043

    ( Supplemental methods section found only in PDF-fulltext )



    Biomart queries include:

      protein_coding (as cDNA)

      lncRNA (as cDNA)

      All remaining gene_biotypes

          as unspliced transcripts ('transcript_exon_intron')



    tRNAs:  genomic tRNA database http://gtrnadb.ucsc.edu/)

    rRNAs:  NCBI Genbank Database, rRNA sequences (NR_003287.4, NR_003286.4);

    miRNAs: miRBase release 22.1 (http://www.mirbase.org): mature human miRNAs.



    These sequences are then formatted in the required {}_{}_{name}_{biotype} header

    format for Hyb, and all extra '.' and '_' symbols are removed.



    Original biotypes from the hOH7 Hyb database are:

    Ig, lincRNA, microRNA, miscRNA, mRNA, mtrRNA, pr-tr, pseudo, rRNA, snoRNA, snRNA, Trec, tRNA

    In this version, biotypes are passed through as with the ensembl 'transcript_biotype' field.



    In order to facillitate unambiguous miRNA alignment, mature iRNA sequences are aligned to the

    reference transcriptome, and any alignemnts within transcripts are masked. This is performed to

    ensure both that each given miRNA sequence has only a single reference alignment, as well as

    to allow miRNA precursor transcripts to be identified as hybrid targets.



    """

    echo "${NOTES}"