https://github.com/soedinglab/xxmotif
XXmotif: eXhaustive, weight matriX-based motif discovery in nucleotide sequences
https://github.com/soedinglab/xxmotif
bioinformatics motif-discovery
Last synced: 19 days ago
JSON representation
XXmotif: eXhaustive, weight matriX-based motif discovery in nucleotide sequences
- Host: GitHub
- URL: https://github.com/soedinglab/xxmotif
- Owner: soedinglab
- License: gpl-3.0
- Created: 2017-04-21T14:42:11.000Z (about 9 years ago)
- Default Branch: master
- Last Pushed: 2017-04-21T14:44:11.000Z (about 9 years ago)
- Last Synced: 2025-01-09T06:51:18.525Z (over 1 year ago)
- Topics: bioinformatics, motif-discovery
- Language: Perl
- Size: 555 KB
- Stars: 1
- Watchers: 6
- Forks: 0
- Open Issues: 2
-
Metadata Files:
- Readme: README
- License: LICENSE
Awesome Lists containing this project
README
#[ ](https://codeship.com/projects/128271)
#"!https://codeship.com/projects/537b9f00-a0d2-0133-1498-46172c989b73/status?branch=master!":https://codeship.com/projects/128271
#{
}[https://codeship.com/projects/128271]
================================================
== How to Use GIMMEmotif from the command line ? ==
================================================
The easiest way to use XXmotif is by the XXmotif web server (http://xxmotif.genzentrum.lmu.de)
From the command line, XXmotif can be used as follows:
Usage: XXmotif OUTDIR SEQFILE [options]
OUTDIR: output directory for all results
SEQFILE: file name with sequences from positive set
Options:
--XXmasker mask the input sequences for homology, repeats and low complexity regions
--XXmasker-pos mask only the positive set for homology, repeats and low complexity regions
--no-graphics run XXmotif without graphical output
-h|--help show this output
--negSet sequence set which has to be used as a reference set
--mops use multiple occurrence per sequence model
--revcomp search in reverse complement of sequences as well (DEFAULT: NO)
--background-model-order order of background distribution (DEFAULT: 2, 8(--negset) )
--pseudo percentage of pseudocounts used (DEFAULT: 10)
-g|--gaps maximum number of gaps used for start seeds [0-3] (DEFAULT: 0)
--type defines what kind of start seeds are used (DEFAULT: ALL)
- possible types: ALL,FIVEMERS,PALINDROME,TANDEM,NOPALINDROME,NOTANDEM
--merge-motif-threshold defines the similarity threshold for merging motifs (DEFAULT: HIGH)
- possible modes: LOW, MEDIUM, HIGH
--batch suppress progress bars (reduce output size for batch jobs)
--maxPosSetSize maximum number of sequences from the positive set used [DEFAULT: all]
--trackedMotif inspect extensions and refinement of a given seed (DEFAULT: not used)
( a possible fivemer SEED for the TATA-Box is: TATAW
a possible palindromic gapped sixmer SEED for GAL4 is: CGG...........CCG )
==================
= Options to include conservation information
==================
--format FASTA|MFASTA defines what kind of format the input sequences have (DEFAULT: FASTA)
--maxMultipleSequences maximum number of sequences used in an alignment [DEFAULT: all]
==================
== Options to include localization information
==================
--localization use localization information to calculate combined P-values
(sequences should have all the same length)
--downstream number of residues in positive set downstream of anchor point (DEFAULT: 0)
==================
== Jump start XXmotif with self-defined motif (skip elongation phase)
==================
-m|--startMotif Start motif (IUPAC characters)
E.g.: -m "TATAWAWR" to jump start XXmotif with a TATA-Box
-p|--profileFile profile file
every column corresponds to one motif position. Every line to A,C,G,T, respectively
E.g To jump start with a TATA-Box PWM the profile File should contain:
0.0 1.0 0.0 1.0 0.5 1.0 0.5 0.5
0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0
0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.5
1.0 0.0 1.0 0.0 0.5 0.0 0.5 0.0
--startRegion expected start position for motif occurrences relative to anchor point (--localization)
--endRegion expected end position for motif occurrences relative to anchor point (--localization)
====================================================================================================================================
====================================================================================================================================
===================================
== Which Output files do exist ? ==
===================================
1.) *_MotifFile.txt: Summary of the motif results
It contains a representation of the found motifs without degenerate nucleotides (Line 1) and including degerenate
nucleotides (Line 4). Line 3 contains the motif significance and information about the motif occurrence.
If zoops or oops model is used, the percentage of sequences with motifs is given, if the mops model is used
only the number of binding sites is given.
If the option "--localization" is used Line 5 gives information about the enriched region (startRegion, endRegion) and
the position with highest motif occurrence (mode) with respect to the anchor point.
1: ----Motif Number 1: ----
2: => C/G/T A/T A T C A/C/G G C/G C/G/T C/G/T C/T C A T C C G/T
3: E-Value: 2.48e-27, occ: 20.00 % (13 of 65 sequences)
4: IUPAC: B W A T C V G S B B Y C A T C C K
5: mode: 57, startRegion: 42 endRegion: 76
6:
7: ----Motif Number 2: ----
8: ...
2.) *_Pvals.txt : Summary of the Pvalues for each motif site
After header information (Line 1 - 3) all sites for all motifs are given including the upstream and downstream sequences.
Star positions are with respect to the sequence start. More information about the sequence with the specified Sequence Number
(seq nb) can be found in file *_sequence.txt
1: ########################################################################################################################
2: ### upstrem site site downstream site seq nb start pos strand site Pval ###
3: ########################################################################################################################
4:
5: Motif 1: B W A T C V G S B B Y C A T C C K E-Value: 2.48e-27
6: GGGTGAAGGGAGGTTGAGCT CAATCAGGCCCCATCCT GCTTCACAGCCTA 2 372 + 3.2566e-05
7: GTTTCTGTGGCGTTCGAGTT CCATCGGCTCCCATCCG GGCTATCCTGCCGCCTTAGC 5 363 + 4.2578e-05
8: CCCTGTCTTTATTTCCTTAC CAATCGGCTGCCATCCG AGGAGCTGAGGAAGCCTAG 8 366 + 6.3485e-07
9: ATTCGGCGGGCAAGCGGGTG TAATCAGCAGCCATCCG TTCTTGGGCATGGTGGCTTC 12 364 + 1.3936e-05
10:...
3.) *_sequence.txt
After header information (Line 1 - 3) Sequence Numbers (seq nb), sequencence length and the header information given in the
input files are given
1: #####################################################################
2: ### seq nb seq length seq header ###
3: #####################################################################
4:
5: 1 401 EP73002 (+) Hs RPL7 range -300 to 100.
6: 2 401 EP73003 (+) Hs RPS8 range -300 to 100.
7: 3 401 EP73015 (+) Hs RPS11 range -300 to 100.
4.) *.pwm
All position weight matrices of the detected motifs are given. Line 1 contains an IUPAC representation of the motif with its E-value.
Lines 2-5 contain the PWM. Every column corresponds to one position. Every line to A, C, G, T, respectively
1: Motif 1: B W A T C V G S B B Y C A T C C K E-Value: 2.48e-27
2: 0.01791 0.57735 0.92700 0.01791 0.01791 0.15777 0.01791 0.01791 0.08784 0.01791 0.08784 0.01791 0.92700 0.01791 0.01791 0.01791 0.01791
3: 0.44610 0.09645 0.02652 0.02652 0.93561 0.58596 0.02652 0.72582 0.37617 0.16638 0.72582 0.93561 0.02652 0.02652 0.93561 0.93561 0.02652
4: 0.37579 0.02614 0.02614 0.02614 0.02614 0.23593 0.93524 0.23593 0.16600 0.51565 0.02614 0.02614 0.02614 0.02614 0.02614 0.02614 0.65552
5: 0.16020 0.30006 0.02034 0.92944 0.02034 0.02034 0.02034 0.02034 0.36999 0.30006 0.16020 0.02034 0.02034 0.92944 0.02034 0.02034 0.30006
5.) *_hf.fasta
If the option "--XXmasker") is used, input sequences are masked for homology, repeats, and low-complexity regions. The output of
XXmasker is stored into this file and subsequently used by XXmotif as input.
6.) *.png
Graphical output of the motif search. It is created if the option (--no-graphics) is not selected and is designed especially for
localized motifs.
Every plot contains the occurrence of the motif ( binding sites / number of sequences), which can be greater than 100% in case of
the "multiple occurrence per sequence model" (--mops).
If the option localization is used (--localization) the position with most motif occurrences is given (max).
The upper part of the plot contains the PWM logo, and the distribution of binding sites selected by XXmotif.
If localization is used, a red bar indicates the region of highest motif enrichment. If no red bar is present, no region contains significantly
enriched motifs.
The lower part of the plot shows the distribution of binding sites with a minimum log-odds score on the forward strand (red) and
on the backward strand (blue).
All binding sites are counted that have log-odds score > 50% of the highest possible log-odds score of the PWM. This plot is useful to
reveal whether the motif is strand specific. Moreover, in case of localized motifs, it is useful to analyze whether there are binding sites
outside the enriched region that are not selected by XXmotif.
The axis at the bottom shows the position of the binding site within the input sequence. If the option "--localization" is selected
it is assumed that the "--downstream" option is used to define the number of nucleotides downstream of the anchor point. If "--downstream" is
not used, it is set to 0. If the motif search is performed on both strands (--revcomp) the reverse strand is simply added after the
forward strand. Hence, the sequences seem to be twice as long.
=====================
== Version Track
=====================
Version 1.6:
- fixed bug reported by Zhihao Ling concerning parameter --max-match-positions
Version 1.5:
- improved speed to read in large input sets (> 10.000 sequences)
Version 1.4:
- report motifs with e-value < 1e2 (before: < 1e3)
Version 1.3:
- removed a bug leading to a segmentation fault when using sequences longer than 16.000 nucleotides
- removed a bug leading to wrongly counted initial seed kmers when using the option --gaps > 0 and for the tandemic seed kmers
- added the option --max-motif-length to allow motifs to be found with length > 17 (larger values than 17 will lead to very long runtimes, maximum possible length is 26)
- added the option --no-pwm-length-optimization to remove the time consuming pwm length optimiziation step in the iterative pwm phase
Version 1.2:
- Version used in the publication