https://github.com/will-rowe/nthash

Go implementation of ntHash
https://github.com/will-rowe/nthash

genomics hashing-algorithm

Last synced: 27 days ago
JSON representation

Go implementation of ntHash

• Host: GitHub
• URL: https://github.com/will-rowe/nthash
• Owner: will-rowe
• License: mit
• Created: 2018-09-18T20:04:35.000Z (over 7 years ago)
• Default Branch: master
• Last Pushed: 2021-09-16T18:43:03.000Z (over 4 years ago)
• Last Synced: 2024-12-07T19:19:18.326Z (about 1 year ago)
• Topics: genomics, hashing-algorithm
• Language: Go
• Size: 20.5 KB
• Stars: 20
• Watchers: 3
• Forks: 2
• Open Issues: 0
• Metadata Files:
  • Readme: README.md
  • License: LICENSE

Awesome Lists containing this project

README

          


  
ntHash

  


ntHash implementation in Go

  


  

  

  

  



---

## Overview

This is a Go implementation of the [ntHash](https://github.com/bcgsc/ntHash) recursive hash function for hashing all possible k-mers in a DNA/RNA sequence.

For more information, read the ntHash [paper](http://dx.doi.org/10.1093/bioinformatics/btw397) by Mohamadi et al. or check out their C++ [implementation](https://github.com/bcgsc/ntHash).

This implementation was inspired by [Luiz Irber](https://luizirber.org/) and his recent [blog post](https://blog.luizirber.org/2018/09/13/nthash/) on his cool [Rust ntHash implementation](https://github.com/luizirber/nthash).

I have coded this up in Go so that ntHash can be used in my [HULK](https://github.com/will-rowe/hulk) and [GROOT](https://github.com/will-rowe/groot) projects but feel free to use it for yourselves.

## Installation

```go

go get github.com/will-rowe/nthash

```

## Example usage

### range over ntHash values for a sequence

```go

package main

import (

    "log"

    "github.com/will-rowe/nthash"

)

var (

    sequence = []byte("ACGTCGTCAGTCGATGCAGTACGTCGTCAGTCGATGCAGT")

    kmerSize = 11

)

func main() {

    // create the ntHash iterator using a pointer to the sequence and a k-mer size

    hasher, err := ntHash.New(&sequence, kmerSize)

    // check for errors (e.g. bad k-mer size choice)

    if err != nil {

        log.Fatal(err)

    }

    // collect the hashes by ranging over the hash channel produced by the Hash method

    canonical := true

    for hash := range hasher.Hash(canonical) {

        log.Println(hash)

    }

}

```