An open API service indexing awesome lists of open source software.

https://github.com/xp3i4/linear

Framework of alignment-free method for variants detection.
https://github.com/xp3i4/linear

alignment-free-algorithm bioinformatics framework genomics

Last synced: about 2 months ago
JSON representation

Framework of alignment-free method for variants detection.

Awesome Lists containing this project

README

          

Linear: ALIgNment-freE framework for long-read vARiants resolution
====
![example workflow](https://github.com/xp3i4/linear/actions/workflows/cmake.yml/badge.svg)
[![License](https://img.shields.io/badge/License-BSD%203--Clause-blue.svg)](https://opensource.org/licenses/BSD-3-Clause)
![platforms](https://img.shields.io/badge/platform-linux-informational.svg)

Linear is a long-read analysis framework that employs methods more flexible and efficient than assembly- or alignment-based ones.
Linear is compatible with existing software including SAMtools, SVs callers, and IGV.

## Build and usage
### Prerequisites
Please make sure the following systems have been installed before building from the source.
- GNU/Linux GCC ≥ 4.9.0
- CMAKE ≥ 3.0.0
- zlib ≥ 1.2

```bash
#To install prerequisites for Debian, Ubuntu, etc.
sudo apt-get install cmake
sudo apt-get install zlib1g zlib1g-dev

#To install prerequisites for RedHat, Fedora, etc.
sudo dnf install cmake
sudo dnf install zlib-devel

#To install cmake prerequisites for Arch, manjaro,etc.
#zlib-dev is not needed
sudo pacman -S cmake
```

### Build from source
```bash
#To build from source, please type in the commandline
mkdir -p build/release && cd $_
CMake [path to source]
make linear -j4 #use 4 threads to compile
```
### Generic usage
```bash
# Specify modules in Linear
linear module [options]
```
```bash
# Check generic help for available modules
linear -h
Linear - options and arguments.
====================================

SYNOPSIS
Linear -h for help

DESCRIPTION
-h, --help
Display this help message.
--version
Display version information.

AVAILABLE SUBMODULES:
filter: The submodule is to detect SVs signals hidden in long reads.
It takes input as long reads and outputs SAM/BAM. Type "linear filter -h" for more info.

```

## Submodules
### 1.Filter
The filter module named Leaf (pipeline B in the figure) is an ultra-fast SV filter for population-scale long-read SV detection.
It is built on generative models, which are computationally efficient and effective in detecting intra-read SVs.
Leaf outputs SAM/BAM*, which is compatible with alignment-based software.


drawing

#### Usage
```bash
#Example 1: Sequence format .fa(stq)(.gz) are supported for input.
linear filter read.fa(stq)(.gz) genome.fa(.gz)
#Following is the status when running the filter
Linear: ALIgNment-free methods for long-read vARiants resolution
--Read genomes
File: all.fa.gz [24 sequences; 2945 mbases; Elapsed time[s] 19.75 100%]
--Index::Initiate[100%]
Index::Hash [100%]
End creating index Elapsed time[s] 22
--SRR9001768.fa
I/O::in :273300 cpu:32.70[s] speed:8358.11[rds/thd/s]
I/O::out:270400 cpu:135.54[s] speed:1995.00[rds/thd/s]
Compute:273000 cpu:472.13[s] speed:1578.24[rds/thd/s]
Processed:270400 time:138.27[s] speed:1955.62[rds/s]
```
```bash
#Example 2: Argument x between the reads and references for more than 2 inputs.
linear filter *.fa(stq)(.gz) x *.fa(.gz)
```
```bash
#Example 3: For options help
Linear filter -h

Linear filter - options and arguments.
===========================================

SYNOPSIS
Linear filter [OPTIONS] read.fa/fastq(.gz) genome.fa(.gz)

DESCRIPTION
-h, --help
Display this help message.
--version
Display version information.

Basic options:
-o, --output STR
Set the prefix of output. The filter will use the prefix of the filename of reads as the prefix of output if
the option isn't set
-ot, --output_type INT
Set the format of the output file. 1 to enable .APF, an approximate map file for non-standard application; 2 to
enable .SAM {DEFAULT}; 4 to enable .BAM; Set values 3 (3=1+2) to enable both .apf and .sam
-t, --thread INT
Set the number of threads to run. -t 4 {DEFAULT}
-g, --gap_len INT
Set the minimal length of gaps. -g 50 {DEFAULT}. -g 0 to turn off map of gaps.
-rg, --read_group STR
Set the name of the read group specified in the SAM header
-sn, --sample_name STR
Set the name of the sample specified in the SAM header

More options (tweak):
-dup, --duplication INT
Redetect duplications for signals of insertions. Enabling (-dup 1) this option will treat many insertions as
duplications. This option is off (-dup 0) {DEFAULT}
-b, --bal_flag INT
Set to Enable/Disable dynamic balancing tasks schedule. -b 1(Enable) {DEFAULT}
-p, --preset INT
Set predefined sets of parameters. -p 0 {DEFAULT} -p 1 efficient -p 2 additional
-i, --index_type INT
Choose the type of indices{1, 2}. -i 1 {DEFAULT}
-c, --apx_c_flag INT
0 to turn off apx map
-f, --feature_type INT
Set types of features {1,2}. -f 2 (2-mer, 48bases){DEFAULT}
-r, --reform_ccs_cigar_flag INT
Enable/Disable compressing the cigar string for Pacbio CCS reads. -r 0(Disable) {DEFAULT}
```
### Compatibility
#### SAMtools ![](https://img.shields.io/badge/v1.10-%20tested-success)

Compatibility with samtools 1.10 has been tested.
Results of the filter are compatible with 'samtools view', 'samtools index' and 'samtools sort'.

#### PBSV ![](https://img.shields.io/badge/v2.6.2-%20tested-success)

PBSV is a SVs caller for PacBio long reads. Compatibility with PBSV has been tested.
Set the sample and group name appropriately with option -s when using pbsv discover.

#### SVIM ![](https://img.shields.io/badge/v1.2.0-%20tested-success)

SVIM is an SVs caller for PacBio and ONT reads.
SVIM takes as input the SAM/BAM.
The compatibility of the filter with SVIM has been tested.
And results of the filter can be processed directly by SVIM with default settings.

#### cuteSV ![](https://img.shields.io/badge/v1.0.13-%20tested-success)

cuteSV is an SVs caller for PacBio and ONT reads.
cuteSV takes as input the SAM/BAM.
The compatibility of the filter with cuteSV has been tested.
And results of the filter can be processed directly by cuteSV with default settings.

#### IGV ![](https://img.shields.io/badge/v2.8.3-%20tested-success)

IGV is a sequencing visualization tool. Compatibility with IGV has been tested.
Please use samtools to convert and index the results of filter before using IGV.
The indexed BAM* can be visualized directly by IGV.

## Result format
### SAM/BAM*
SAM/BAM* is an extension of standard SAM/BAM for virtual alignemnt.
It is a superset of the standard SAM/BAM.
It also supports alignment whose SAM/BAM* is identical to the standard SAM/BAM.

3 fields in the standard format are redefined:

- The 6th column, cigar string(denoted by cigar*), is redefined.
cigar* string includes 4 types of cigar pairs as shown in the following figure where the virtual alignment from A to E are expressed by the cigar pairs =I, =D, XI, and XD.


drawing

- The 10th column, SEQ*, is subsequence from read or reference.

- The 12th column, tag* 'SA:Z', is redefined.
Other tags are identical to the standard tag, which can be found at [SAM/BAM format](https://samtools.github.io/hts-specs/SAMv1.pdf) and [Optional tags](https://samtools.github.io/hts-specs/SAMtags.pdf).

```bash
#An example of records in SAM/BAM*.
#SEQs are generated according to cigars rather than segments of read.
#Bases in SEQs corresponding to ’49S’ are from read;
#Bases in SEQs corresponding to ’6=’ are from genome;
#Bases in SEQs corresponding to '1I' are from read;
#Bases in SEQs corresponding to ’35X’ are from read.
# if the base is unequal to the corresponding base in the genome,
# otherwise the ’N’ is inserted.
#SA:Z tag is generated according to the cigars and SEQs.

@HD VN:1.6
@SQ SN:chr10 LN:135534747
@PG PN:Linear
@RG ID:1 SM:1
m140612_082500_42156_c100652082550000001823118110071461_s1_p0/104454/5061_10840
0 chr10 59256034 255 49S6=1I34=1I31=5I30=1I110=2I1=1I49=3I11=2I49=1I6=4I44=2I74
=16I1=1I51=17I96=35X26I66=5I40=3I70=2I101=5319S * 0 0 TAGCATAAGCTCTTTAGTTTAATTAG
ATCAGACATTTGTCAATGTTTGTGTCAATGGTTGGCTTTTGTTGCCTTTGCTTTTAGTGTTTTAAGTCATGAAGTCTTTG
...CCACTTGTGTAGAGAGGATGTGGAGAAAAAGAAATGCTTTTACACAGTTGGTGGGAGTGTAAATTCGTTCAACCACT
GTAGAAGACAGTGTTGTGATTCCTCAAGACACACNNNTTTTNCGCNNNTTTAANNNCTTTGNAGAACCCAACAATTAATA
...AGCTGGAAACCATCATTCTCAGCAAACTAACACAGGAACAGAAAACCAAACAC * SA:Z:chr10,59257622,-
,4379S320M5I4884S,255,27;chr10,59257982,+,1371S3138M338I146S,255,528;
```