https://github.com/rishav394/java-programming-cse1007

This repository is going to have all the solutions to cycle sheet from CSE1007 - Java Programming at VIT University, Vellore.
https://github.com/rishav394/java-programming-cse1007

Last synced: 2 months ago
JSON representation

This repository is going to have all the solutions to cycle sheet from CSE1007 - Java Programming at VIT University, Vellore.

• Host: GitHub
• URL: https://github.com/rishav394/java-programming-cse1007
• Owner: rishav394
• Created: 2020-01-27T19:11:05.000Z (over 6 years ago)
• Default Branch: master
• Last Pushed: 2020-02-18T06:02:50.000Z (over 6 years ago)
• Last Synced: 2025-03-16T13:24:06.828Z (over 1 year ago)
• Language: Java
• Homepage: https://rishav394.github.io/Java-Programming-CSE1007/
• Size: 23.4 KB
• Stars: 2
• Watchers: 0
• Forks: 0
• Open Issues: 0
• Metadata Files:
  • Readme: README.md

Awesome Lists containing this project

README

          
# Java Programming CSE1007

This repository is going to have all the solutions to cycle sheet from CSE1007-Java Programming at VIT University, Vellore.

## Assignments - 13329 - DEEPIKAA S

Since I have this course under her I will also upload the assignments she gives apart from the cycle sheet

*  [Prime Number]()

*  [Pyramid pattern]()

*  [Right angle triangle pattern]()

*  [Simple and Comound interest]()

## Assignments - 10247 - JAISANKAR N

* [Current And Saving Accounts]()

## Cycle Sheet (List of Challenging Experiments (Indicative))

Each assignment number from List of Challenging Experiments is named as `q[number]` under the Cycle Sheet folder. It can be a direct `.java` file or a folder, if the solution contains more than one files or deals with custom packages. Or you can just navigate to that file by clicking these links below.

1. Write a program to demonstrate the knowledge of students in basic Java concepts. [Solution](Cycle%20Sheet/q1.java)

    >Eg., Write a program to read the First name and Last name of a person, his weight and height using command line arguments. Calculate the BMI Index which is defined as the individual's body mass divided by the square of their height.

    >

    >| Category | BMI Range-Kg/m2 |

    >|------------------------------- |----------------------- |

    >| Underweight | <18.5 |

    >| Normal (healthy weight) | 18.5 to 25 |

    >| Overweight | 25 to 30 |

    >| Obese Class | Over 30 |

    >

    >Display the name and display his category based on the BMI value thus calculated.

  

2. Write a program to demonstrate the knowledge of students in multidimensional arrays and looping constructs. [Solution](Cycle%20Sheet/q2.java)

    > Eg., If there are 4 batches in BTech(IT) learning ‘ITE2005’ course, read the count of the slow learners (who have scored <25) in each batch. Tutors should be assigned in the ratio of 1:4 (For every 4 slow learners, there should be one tutor). Determine the number of tutors for each batch. Create a 2-D jagged array with 4 rows to store the count of slow learners in the 4 batches. The number of columns in each row should be equal to the number of groups formed for that particular batch ( Eg., If there are 23 slow learners in a batch, then there should be 6 tutors and in the jagged array, the corresponding row should store 4, 4, 4, 4, 4,3). Use for-each loop to traverse the array and print the details. Also print the number of batches in which all tutors have exactly 4 students.

3. Write a program to demonstrate the knowledge of students in String handling. [Solution](Cycle%20Sheet/q3.java)

    > Eg., Write a program to read a chemical equation and find out the

    > count of the reactants and the products. Also display the count of the

    > number of molecules of each reactant and product.

    > 

    > Eg., For the equation, 2NaOH + H2SO4 -> Na2SO4+ 2H2O,  the O/P  should

    > be as follows.

    > 

    > Reactants are 2 moles of NaOH,  1 mole of H2SO4.

    > 

    > Products are 1 mole of Na2SO4 and 2 moles of H2O

4. Write a program to demonstrate the knowledge of students in advanced concepts of Java string handling. [Solution](Cycle%20Sheet/q4.java)

    > Eg., (_Bioinformatics: finding genes_) Biologists use a sequence of

    > letters **A**, **C**, **T**, and **G** to model a genome. A gene is a

    > substring of a genome that starts after a triplet **ATG** and ends

    > before a triplet **TAG**, **TAA**, or **TGA**. Furthermore, the length

    > of a gene string is a multiple of 3 and the gene does not contain any

    > of the triplets **ATG**, **TAG**, **TAA**, and **TGA**. Write a

    > program that prompts the user to enter a genome and displays all genes

    > in the genome. If no gene is found in the input sequence, displays no

    > gene. Here are the sample runs:

    > 

    > Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT

    > 

    > O/P:  TTT

    > 

    > GGGCGT

5. Write a program to demonstrate the knowledge of students in working with classes and objects. [Solution](Cycle%20Sheet/q5.java)

    > Eg.,Create a class Film with string objects which stores name,

    > language and lead_actor and category (action/drama/fiction/comedy).

    > Also include an integer data member that stores the duration of the

    > film. Include parameterized constructor, default constructor and

    > accessory functions to film class. Flim objects can be initialized

    > either using a constructor or accessor functions. Create a class

    > FilmMain that includes a main function. In the main function create a

    > vector object that stores the information about the film as objects.

    > Use the suitable methods of vector class to iterate the vector object

    > to display the following

    > 

    > a. The English film(s) that has Arnold

    > as its lead actor and that runs for shortest duration.

    > 

    > b. The Tamil film(s) with Rajini as

    > lead actor.

    > 

    > c. All the comedy movies.

6. Write a program to demonstrate the knowledge of students in creation of abstract classes and working with abstract methods. [Solution](Cycle%20Sheet/q6.java)

    > Eg., Define an abstract class ‘Themepark’ and inherit 2 classes

    > ‘Queensland’ and ‘Wonderla’ from the abstract class. In both the theme

    > parks, the entrance fee for adults is Rs. 500 and for children it is

    > Rs. 300. If a family buys ‘n’ adult tickets and ‘m’ children tickets,

    > define a method in the abstract class to calculate the total cost.

    > Also, declare an abstract method playGame() which must be redefined in

    > the subclasses.

    > 

    > In Queensland, there are a total of 30 games. Hence create a Boolean

    > array named ‘Games’ of size 30 which initially stores false values for

    > all the elements. If the player enters any game code that has already

    > been played, a warning message should be displayed and the user should

    > be asked for another choice.  In Wonderla, there are a total of 40

    > different games. Thus create an integer array with 40 elements. Here,

    > the games can be replayed, until the user wants to quit. Finally

    > display the total count of games that were repeated and count of the

    > games which were not played at all.

7. Write a program to demonstrate the knowledge of students in Java Exception handling. [Solution](Cycle%20Sheet/q7.java)

    > Eg., Read the Register Number and Mobile Number of a student. If the

    > Register Number does not contain exactly 9 characters or if the Mobile

    > Number does not contain exactly 10 characters, throw an

    > IllegalArgumentException.  If the Mobile Number contains any character

    > other than a digit, raise a NumberFormatException. If the Register

    > Number contains any character other than digits and alphabets, throw a

    > NoSuchElementException. If they are valid, print the message ‘valid’

    > else ‘invalid’

8. Write a program to demonstrate the knowledge of students in working with user-defined packages and sub-packages. [Solution](Cycle%20Sheet/q8)

    > Eg., Within the package named ‘primespackage’, define a class Primes

    > which includes a method checkForPrime() for checking if the given

    > number is prime or not. Define another class named TwinPrimes outside

    > of this package which will display all the pairs of prime numbers

    > whose difference is 2. (Eg, within the range 1 to 10, all possible

    > twin prime numbers are (3,5), (5,7)). The TwinPrimes class should make

    > use of the checkForPrime() method in the Primes class.

9. Write a program to demonstrate the knowledge of students in File handling. [Half solution](Cycle%20Sheet/q9.java)

    > Eg., Define a class ‘Donor’ to store the below mentioned details of  a

    > blood donor.

    > 

    > Name, age, Address, Contact number, blood group, date of last donation

    > 

    > Create ‘n’ objects of this class for all the regular donors at

    > Vellore. Write these objects to a file. Read these objects from the

    > file and display only those donors’ details whose blood group is

    > ‘A+ve’ and had not donated for the recent six months.

## Disclaimer

[I (rishav394)](https://github.com/rishav394/) take no responsibility for any code, be it working or not what so ever.

If you find some bug or a suggestion please open an issue or create a pull request or drop me an email at rishav394@gmail.com

## Contributions

* [rishav394](https://github.com/rishav394/) - original work

    > Feel free to add your name and respective contribution when submitting a pull request.