https://github.com/shenwei356/unikmer
A versatile toolkit for k-mers with taxonomic information
https://github.com/shenwei356/unikmer
difference golang intersection k-mer kmer set unik union unique
Last synced: 2 months ago
JSON representation
A versatile toolkit for k-mers with taxonomic information
- Host: GitHub
- URL: https://github.com/shenwei356/unikmer
- Owner: shenwei356
- License: mit
- Created: 2018-08-09T15:44:35.000Z (over 7 years ago)
- Default Branch: master
- Last Pushed: 2024-08-06T07:39:45.000Z (over 1 year ago)
- Last Synced: 2024-08-06T11:21:27.434Z (over 1 year ago)
- Topics: difference, golang, intersection, k-mer, kmer, set, unik, union, unique
- Language: Go
- Homepage: https://bioinf.shenwei.me/unikmer
- Size: 6.18 MB
- Stars: 73
- Watchers: 3
- Forks: 7
- Open Issues: 4
-
Metadata Files:
- Readme: README.md
- Changelog: CHANGELOG.md
- License: LICENSE
Awesome Lists containing this project
- awesome-bio-go - unikmer - mers with taxonomic information. (Sequence Analysis and Manipulation)
README
# unikmer: a versatile toolkit for k-mers with taxonomic information
Documents: https://bioinf.shenwei.me/unikmer/
`unikmer` is a toolkit for nucleic acid [k-mer](https://en.wikipedia.org/wiki/K-mer) analysis,
providing functions
including set operation k-mers (sketch) optional with
TaxIds but without count information.
K-mers are either encoded (k<=32) or hashed ([k<=64, using ntHash v1](https://github.com/bcgsc/ntHash/issues/41)) into `uint64`,
and serialized in binary file with extension `.unik`.
TaxIds can be assigned when counting k-mers from genome sequences,
and LCA (Lowest Common Ancestor) is computed during set opertions
including computing union, intersecton, set difference, unique and
repeated k-mers.
Related projects:
- [kmers](https://github.com/shenwei356/kmers) provides bit-packed k-mers methods for this tool.
- [unik](https://github.com/shenwei356/unik) provides k-mer serialization methods for this tool.
- [sketches](https://pkg.go.dev/github.com/shenwei356/bio/sketches) provides generators/iterators for k-mer sketches
([Minimizer](https://academic.oup.com/bioinformatics/article/20/18/3363/202143),
[Scaled MinHash](https://f1000research.com/articles/8-1006),
[Closed Syncmers](https://peerj.com/articles/10805/)).
- [taxdump](https://github.com/shenwei356/bio/tree/master/taxdump) provides querying manipulations from NCBI Taxonomy taxdump files.
## Table of Contents
- [Using cases](#using-cases)
- [Installation](#installation)
- [Commands](#commands)
- [Binary file](#binary-file)
- [Quick start](#quick-start)
- [Support](#support)
- [License](#license)
## Using cases
- Finding conserved regions in all genomes of a species.
- Finding species/strain-specific sequences for designing probes/primers.
## Installation
1. Downloading [executable binary files](https://github.com/shenwei356/unikmer/releases).
1. Via Bioconda [](https://anaconda.org/bioconda/unikmer) [](https://anaconda.org/bioconda/unikmer)
conda install -c bioconda unikmer
## Commands
[Usages](https://bioinf.shenwei.me/unikmer/usage)
1. Counting
count Generate k-mers (sketch) from FASTA/Q sequences
1. Information
info Information of binary files
num Quickly inspect the number of k-mers in binary files
1. Format conversion
view Read and output binary format to plain text
dump Convert plain k-mer text to binary format
encode Encode plain k-mer texts to integers
decode Decode encoded integers to k-mer texts
1. Set operations
concat Concatenate multiple binary files without removing duplicates
inter Intersection of k-mers in multiple binary files
common Find k-mers shared by most of the binary files
union Union of k-mers in multiple binary files
diff Set difference of k-mers in multiple binary files
1. Split and merge
sort Sort k-mers to reduce the file size and accelerate downstream analysis
split Split k-mers into sorted chunk files
tsplit Split k-mers according to TaxId
merge Merge k-mers from sorted chunk files
1. Subset
head Extract the first N k-mers
sample Sample k-mers from binary files
grep Search k-mers from binary files
filter Filter out low-complexity k-mers
rfilter Filter k-mers by taxonomic rank
1. Searching on genomes
locate Locate k-mers in genome
map Mapping k-mers back to the genome and extract successive regions/subsequences
1. Misc
autocompletion Generate shell autocompletion script
version Print version information and check for update
## Binary file
[](https://pkg.go.dev/github.com/shenwei356/unik)
K-mers (represented in `uint64` in RAM ) are serialized in 8-Byte
(or less Bytes for shorter k-mers in compact format,
or much less Bytes for sorted k-mers) arrays and
optionally compressed in gzip format with extension of `.unik`.
TaxIds are optionally stored next to k-mers with 4 or less bytes.
### Compression ratio comparison
No TaxIds stored in this test.

label |encoded-kmera|gzip-compressedb|compact-formatc|sortedd|comment
:---------------|:----------------------:|:-------------------------:|:------------------------:|:----------------:|:------------------------------------------------------
`plain` | | | | |plain text
`gzip` | |✔ | | |gzipped plain text
`unik.default` |✔ |✔ | | |gzipped encoded k-mers in fixed-length byte array
`unik.compat` |✔ |✔ |✔ | |gzipped encoded k-mers in shorter fixed-length byte array
`unik.sorted` |✔ |✔ | |✔ |gzipped sorted encoded k-mers
- a One k-mer is encoded as `uint64` and serialized in 8 Bytes.
- b K-mers file is compressed in gzip format by default,
users can switch on global option `-C/--no-compress` to output non-compressed file.
- c One k-mer is encoded as `uint64` and serialized in 8 Bytes by default.
However few Bytes are needed for short k-mers, e.g., 4 Bytes are enough for
15-mers (30 bits). This makes the file more compact with smaller file size,
controled by global option `-c/--compact `.
- d One k-mer is encoded as `uint64`, all k-mers are sorted and compressed
using varint-GB algorithm.
- In all test, flag `--canonical` is ON when running `unikmer count`.
## Quick Start
# memusg is for compute time and RAM usage: https://github.com/shenwei356/memusg
# counting (only keep the canonical k-mers and compact output)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23 --canonical --compact
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23 --canonical --compact
elapsed time: 0.897s
peak rss: 192.41 MB
# counting (only keep the canonical k-mers and sort k-mers)
# memusg -t unikmer count -k 23 Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted --canonical --sort
$ memusg -t unikmer count -k 23 Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted --canonical --sort
elapsed time: 1.136s
peak rss: 227.28 MB
# counting and assigning global TaxIds
$ unikmer count -k 23 -K -s Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta.gz.k23.sorted -t 585057
$ unikmer count -k 23 -K -s Ecoli-MG1655.fasta.gz -o Ecoli-MG1655.fasta.gz.k23.sorted -t 511145
$ unikmer count -k 23 -K -s A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.sorted -t 349741
# counting minimizer and ouputting in linear order
$ unikmer count -k 23 -W 5 -H -K -l A.muciniphila-ATCC_BAA-835.fasta.gz -o A.muciniphila-ATCC_BAA-835.fasta.gz.m
# view
$ unikmer view Ecoli-MG1655.fasta.gz.k23.sorted.unik --show-taxid | head -n 3
AAAAAAAAACCATCCAAATCTGG 511145
AAAAAAAAACCGCTAGTATATTC 511145
AAAAAAAAACCTGAAAAAAACGG 511145
# view (hashed k-mers needs original FASTA/Q file)
$ unikmer view --show-code --genome A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 3
CATCCGCCATCTTTGGGGTGTCG 1210726578792
AGCGCAAAATCCCCAAACATGTA 2286899379883
AACTGATTTTTGATGATGACTCC 3542156397282
# find the positions of k-mers
$ unikmer locate -g A.muciniphila-ATCC_BAA-835.fasta.gz A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik | head -n 5
NC_010655.1 2 25 ATCTTATAAAATAACCACATAAC 0 .
NC_010655.1 5 28 TTATAAAATAACCACATAACTTA 0 .
NC_010655.1 6 29 TATAAAATAACCACATAACTTAA 0 .
NC_010655.1 9 32 AAAATAACCACATAACTTAAAAA 0 .
NC_010655.1 13 36 TAACCACATAACTTAAAAAGAAT 0 .
# info
$ unikmer info *.unik -a -j 10
file k canonical hashed scaled include-taxid global-taxid sorted compact gzipped version number description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik 23 ✓ ✓ ✕ ✕ ✕ ✕ ✓ v5.0 860,900
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik 23 ✓ ✕ ✕ ✕ 349741 ✓ ✕ ✓ v5.0 2,630,905
Ecoli-IAI39.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 585057 ✓ ✕ ✓ v5.0 4,902,266
Ecoli-IAI39.fasta.gz.k23.unik 23 ✓ ✕ ✕ ✕ ✕ ✓ ✓ v5.0 4,902,266
Ecoli-MG1655.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 511145 ✓ ✕ ✓ v5.0 4,546,632
Ecoli-MG1655.fasta.gz.k23.unik 23 ✓ ✕ ✕ ✕ ✕ ✓ ✓ v5.0 4,546,632
# concat
$ memusg -t unikmer concat *.k23.sorted.unik -o concat.k23 -c
elapsed time: 1.020s
peak rss: 25.86 MB
# union
$ memusg -t unikmer union *.k23.sorted.unik -o union.k23 -s
elapsed time: 3.991s
peak rss: 590.92 MB
# or sorting with limited memory.
# note that taxonomy database need some memory.
$ memusg -t unikmer sort *.k23.sorted.unik -o union2.k23 -u -m 1M
elapsed time: 3.538s
peak rss: 324.2 MB
$ unikmer view -t union.k23.unik | md5sum
4c038832209278840d4d75944b29219c -
$ unikmer view -t union2.k23.unik | md5sum
4c038832209278840d4d75944b29219c -
# duplicate k-mers
# memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d -m 1M # limit memory usage
$ memusg -t unikmer sort *.k23.sorted.unik -o dup.k23 -d
elapsed time: 1.143s
peak rss: 240.18 MB
# intersection
$ memusg -t unikmer inter *.k23.sorted.unik -o inter.k23
elapsed time: 1.481s
peak rss: 399.94 MB
# difference
$ memusg -t unikmer diff -j 10 *.k23.sorted.unik -o diff.k23 -s
elapsed time: 0.793s
peak rss: 338.06 MB
$ ls -lh *.unik
-rw-r--r-- 1 shenwei shenwei 6.6M Sep 9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik
-rw-r--r-- 1 shenwei shenwei 9.5M Sep 9 17:24 A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik
-rw-r--r-- 1 shenwei shenwei 46M Sep 9 17:25 concat.k23.unik
-rw-r--r-- 1 shenwei shenwei 9.2M Sep 9 17:27 diff.k23.unik
-rw-r--r-- 1 shenwei shenwei 11M Sep 9 17:26 dup.k23.unik
-rw-r--r-- 1 shenwei shenwei 18M Sep 9 17:23 Ecoli-IAI39.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei 29M Sep 9 17:24 Ecoli-IAI39.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei 17M Sep 9 17:23 Ecoli-MG1655.fasta.gz.k23.sorted.unik
-rw-r--r-- 1 shenwei shenwei 27M Sep 9 17:25 Ecoli-MG1655.fasta.gz.k23.unik
-rw-r--r-- 1 shenwei shenwei 11M Sep 9 17:27 inter.k23.unik
-rw-r--r-- 1 shenwei shenwei 26M Sep 9 17:26 union2.k23.unik
-rw-r--r-- 1 shenwei shenwei 26M Sep 9 17:25 union.k23.unik
$ unikmer stats *.unik -a -j 10
file k canonical hashed scaled include-taxid global-taxid sorted compact gzipped version number description
A.muciniphila-ATCC_BAA-835.fasta.gz.m.unik 23 ✓ ✓ ✕ ✕ ✕ ✕ ✓ v5.0 860,900
A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik 23 ✓ ✕ ✕ ✕ 349741 ✓ ✕ ✓ v5.0 2,630,905
concat.k23.unik 23 ✓ ✕ ✕ ✓ ✕ ✓ ✓ v5.0 -1
diff.k23.unik 23 ✓ ✕ ✕ ✓ ✓ ✕ ✓ v5.0 2,326,096
dup.k23.unik 23 ✓ ✕ ✕ ✓ ✓ ✕ ✓ v5.0 2,576,170
Ecoli-IAI39.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 585057 ✓ ✕ ✓ v5.0 4,902,266
Ecoli-IAI39.fasta.gz.k23.unik 23 ✓ ✕ ✕ ✕ ✕ ✓ ✓ v5.0 4,902,266
Ecoli-MG1655.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 511145 ✓ ✕ ✓ v5.0 4,546,632
Ecoli-MG1655.fasta.gz.k23.unik 23 ✓ ✕ ✕ ✕ ✕ ✓ ✓ v5.0 4,546,632
inter.k23.unik 23 ✓ ✕ ✕ ✓ ✓ ✕ ✓ v5.0 2,576,170
union2.k23.unik 23 ✓ ✕ ✕ ✓ ✓ ✕ ✓ v5.0 6,872,728
union.k23.unik 23 ✓ ✕ ✕ ✓ ✓ ✕ ✓ v5.0 6,872,728
# -----------------------------------------------------------------------------------------
# mapping k-mers to genome
seqkit seq Ecoli-IAI39.fasta.gz -o Ecoli-IAI39.fasta
g=Ecoli-IAI39.fasta
f=inter.k23.unik
# mapping k-mers back to the genome and extract successive regions/subsequences
unikmer map -g $g $f -a | more
# using bwa
# to fasta
unikmer view $f -a -o $f.fa.gz
# make index
bwa index $g; samtools faidx $g
ncpu=12
ls $f.fa.gz \
| rush -j 1 -v ref=$g -v j=$ncpu \
'bwa aln -o 0 -l 17 -k 0 -t {j} {ref} {} \
| bwa samse {ref} - {} \
| samtools view -bS > {}.bam; \
samtools sort -T {}.tmp -@ {j} {}.bam -o {}.sorted.bam; \
samtools index {}.sorted.bam; \
samtools flagstat {}.sorted.bam > {}.sorted.bam.flagstat; \
/bin/rm {}.bam '
## Support
Please [open an issue](https://github.com/shenwei356/unikmer/issues) to report bugs,
propose new functions or ask for help.
## License
[MIT License](https://github.com/shenwei356/unikmer/blob/master/LICENSE)